Wednesday, September 2, 2020

La Chteau Versailles essays

La Chteau Versailles articles In 1669 an interesting chasing lodge a couple of miles outside of Paris was assigned to get one of the most amazing, generally lovely, and most expand strongholds that the world has ever observed. The Palace Versailles assisted with building up King Louis XIV as a Grand Monarch, and was the standard with which different royal residences were estimated. The single demonstration of creation with respect to Louis XIV impelled him into the records of history as an extraordinary pioneer and legislator, however a practiced designer also. Versailles stands today as a confirmation of the greatness and boldness of the Baroque time frame in European history, and its enduring effect on our present day. La Chteau Versailles was a mammoth work of a hybrid of old style and rococo styles. Its outside is embellished in traditional styling, however its sheer size shows its connections to the Baroque time of workmanship and engineering. The style wherein it was developed was most likely the same old thing to the individuals of France, what was particular about it was the size. In the event that Versailles had been 100 meters wide rather than almost multiple times that, it would have just been another manor. But since of its size the Palace Versailles has gotten one of the most examined and cherished castles on the planet. It is a solitary case of the Frenchs capacity to merge to apparently inverse thoughts into one great bit of engineering. Was it essential for the lord to make such a royal residence? It truly is entertaining that the lord saw the need to build such a scene. It was notable that his development of the royal residence was in a longing to show his adversaries and pundits that he was almighty. Louis XIV was, at the hour of development, one of the most influential men on earth. However in what might appear to be a practically neurotic perspective he planned and requested the structure of a royal residence so enormous in scale that it would leave little uncertainty in anyones mind whom the lord really was. The possibility that ownership is power is... <!

Saturday, August 22, 2020

Indirect Message Essay Example | Topics and Well Written Essays - 250 words

Aberrant Message - Essay Example This implies all the directors are as of now bustling appended to separate working project. It is with these reasons that we wish to illuminate you that we won't be in a situation to take part in the rebuilding of the authentic zone of Miramar. Thusly, a portion of our tasks will be incapacitated since we just have the insignificant number of the upper-level supervisors starting at now. Quite, reclamation of the said recorded zone would require somebody with upper-level administration experience who can give initiative and direct open relationship exercises. Thinking about this, great notoriety, and present and previous tasks of SCORE comparable to recovery programs, they come energetically prescribed to assume control over the activity. We, along these lines, certainly imagine that you can contact SCORE for more help. In any case, it is additionally significant that you note that Kellstrom Industries can't overlook the organization and affiliation that we have delighted in before, and further, we despite everything search forward for more cooperation in the

Friday, August 21, 2020

Cashflow Statements - Three examples Essay Example for Free

Income Statements Three models Essay Records Payable expanded in both first years, particularly in 1990. For 1991 the sum diminished. III) Assessment of the budgetary quality: Own appraisal of the monetary quality of the organization, why? The Gamma Corporation understands a procedure of rebuild and securing. A great deal of acquisition of plant, property, and hardware and high qualities in deterioration and amortization depict the firm’s circumstance best while it is additionally well managedâ from a money related point of view. Despite the fact that the announced net gain of particularly the most recent year 1991 shows a reasonable shortfall -  ­? which may demonstrate a feeble money related circumstance  ­? the organization is as yet stable from a money point of view and appears to get ready for what's to come. A rebuilding hold has been executed which proofs the progressing rebuilding process. The net incomes from working exercises appear over every one of the three years (regardless of a slightâ decrease) a monetarily steady circumstance on account of working incomes. Likewise, the company despite everything arranges an enormous measure of money and money counterparts with the goal that no danger of chapter 11 can be seen. The organization has a protected line of money holds every year up until now. The main thing muddled is the situation of â€Å"Other adjustments† in each of the three years. All things considered, Gamma Corporation is by all accounts in good shape and arrangement for the coming budgetary years.

Thursday, May 28, 2020

Theology, the Church and the Marginalized Essay #2 - 4125 Words

Theology, the Church and the Marginalized Essay #2 (Essay Sample) Content: Theology, the Church and the Marginalized: Toward a Multi-Faith Approach to Dealing with Poverty in the United States of AmericaAuthorClassDate1. Problem StatementPoverty is a complex phenomenon with many dimensions that affects people and is viewed in a wide range of ways by people. It is relative- no single definition fits all descriptions of poverty. It also is not caused by the lack of one thing, but by many different factors that are found in the experiences of people that fit the peoples definition of poverty. Among definitions that are widely held for poverty, it is described as the inadequacy of people to meet their own basic needs. It is also defined as lack of resources that would facilitate provision of needs to people, or the inability of people to engage in economically productive activities to meet their own needs. Scholars widely agree that poverty is a leading cause of crime and conflict, and that reducing poverty levels would reduce the rate of cri me and conflict in affected area. Ikejiaku cites that poverty that is linked to political strive is the leading cause of conflict. He elaborates that groups of people with with a common interest on ideas or interests may reach a point of negotiation and agreement on how to trade them, but a common interest on basic needs is not negotiable and is likely to result in conflict. Statistics in America relate poverty to race, where the American white community is the least poor, and the black and Hispanic communities are the poorest. It could be argue that communities that are native to America have less poverty level than those that are not indigenous to America. Numerous studies have also shown that poverty and unemployment are related directly with crime, and that communities that are discriminated against are likely to engage in criminal activities than those that are not.Crime and poverty are therefore inseparable and to reduce crime, poverty has to be reduced.Poverty is often l inked to destitution and this applies to all countries and communities. This brings the description of poverty to a common concept that equally applies to all people and gauges them on the same level. Measuring absolute poverty, however, is still difficult. Poverty measured by destitution gauges the poverty level of a person in relation to the way the person is disadvantaged socially or financially as compared to other people in their community. The classification of the poor and not poor in such a community may not be transferable to another community, but would only apply in that community or environment. Poverty is also linked to religion in that communities that have a high poverty level tend to show more religious involvement than those that have a low poverty level. According to Paul, there is a significant correlation between poverty and religion. In a number of studies, he was able to establish that societies that are highly successful and religiosity have a correlation of about 0.7. This is a low score that shows lack of correlation. Paul observes that religion is on the decline in countries in the West, and on the increase in developing countries, and he attributes this to the tendency of the poor to seek reprieve from their predicament from a higher being. Pauls assertion gives a view that the poor identify more with religion than the non-poor. The relationship between poverty and religion is still not clear. While poverty has been linked to a variety of things, the given link between it and religion is not substantial enough, and requires more study. This paper will examine the relationship between religion and poverty with a Christian perspective to determine key issues that relate the two. Through this study a deeper understanding of the role of religion on society will be understood and a multi-religious approach to poverty eradication developed. 2. Literature ReviewThe biblical concept of poverty is based on the descriptions of those consi dered vulnerable and unable to meet their own needs through decent economical activities. In the Old Testament, the wealthy owned large pieces of land, and/or participated in farming both crop and livestock keeping, and traded in precious commodities. Other economical activities included general commodity trading, production of goods such as textile, and artisan activities like carpentry and tent making. Those who were peasants and artisans usually could earn a decent living, but were rarely earning enough to be considered rich in the society. The rich were usually few in the society and often very rich. Poverty in those times referred to destitution, where the poor had to engage in activities like begging, selling themselves to slavery, crime, or prostitution to survive. Bauckham identifies key groups of people that were frequently regarded as poor in the Old Testament as day laborers, aliens, orphans and widows. Furthermore, slaves were not grouped in the category of the poo r in the Old Testament. They were usually treated much better than laborers because at least their owners were concerned with their livelihood rather than just obtaining service from them as is the case with day laborers. Slaves were offered accommodation and subsistence and were more or less like extended members of the family.The prevalent view of the early fathers of Christianity to poverty paints a new concept of poverty- that it is an undesired and more of an unprivileged condition than an active result of a persons activity. Teachings of the early church indicated that poverty is a condition that will always be with man and that the wealthy should freely share their wealth with the poor. In this context, the notion that poverty is a punishment from God holds no ground because through logic, the same God could not command His people to share their wealth with the poor if indeed He was out to punish them. Poverty in the early church was more a result of oppression than of th e poors own lack of zeal, laziness, or individual action. Usually the wealthy acquired their wealth through conquest, and other privileges like inheritance and therefore they were require to share their wealth freely with the poor. In some cases wealth was the result of the individuals hard work, but in such cases, it was viewed that the person was enabled by God to make wealth, and therefore was also required to share it freely with the poor. The Bible in several occasions promised a blessing from God to those who gave to the poor. Fox  observes that Gods command for the wealthy to share their wealth with the poor as a concern for justice rather than the poor themselves. The wealthy in numerous occasions acquired their wealth through oppressive means that denied the poor their right to wealth. According to the early church, all people have a right to work, engage in activities that create wealth, and own land and property. In this case, god was against those who denied people these rights and therefore he demanded the sharing of wealth by those who were wealthy.The conduct of missionaries as they entered new grounds spreading the gospel of Jesus was often interpreted to relate poverty with Godliness. Many times Missionaries had a challenge to present the Gospel in a hostile environment, while trying to uphold good conduct without showing love for worldly possessions. In many communities particularly in Africa, missionary work was ridiculed and the missionaries held in suspicion. They often lived in hardship many times required to travel long distance in their missionary work. Furthermore, the missionaries taught that poverty is close to Godliness through statements like blessed are the poor, for they shall see God. Those who were converted to Christianity found a place for consolation in their problems and some felt comfortable in their poverty. While most missionaries did not discourage accumulation of wealth, their comforting of the poor had the im pact of changing the poors attitude towards acquiring wealth. Missionaries were however credited with not only spreading the Gospel but also western education and culture. The missionaries often doubled as educators and spent their time persuading the natives of their mission fields to go for school lessons to enable them read the bible. In the long run missionary work laid the foundation for education in many communities in Africa and the developing world, and contributed to development. Through history, the concept of wealth and poverty has been dynamic and dictated by the economical activities of the time and socio-economic factors like attitudes of people to work, career development and societal values to wealth. Modernity poverty was defined and gauged in terms of actual value of materials, while post modernity poverty is based more on contractual wealth, or what is commonly referred to as paper money. While there is no common consensus among scholars on when modernity gave way to post modernity, there is a distinctive departure of the description of wealth between the two eras. Probably the single event that signifies this transition is the Brettonwoods agreement of 1944 and its consequent collapse in around 1972, which was the beginning of free flowing currencies that were not pegged to equivalent amounts of real wealth gold. The distinctive feature between the period before the Brettonwoods agreement and after is the way economies equated their cash to tangible wealth like gold or precious stones. In this case the cash that an economy had could not surpass the total amount of gold and other valuables the country had, and money represented what a country had. Wealth in post modernity became representative of more than just tangible wealth, but other forms of wealth that was not tangible such as intellect...

Saturday, May 16, 2020

The Topic Of Farming And Poverty - 1065 Words

Writing commentary I decided to write an article for the readers of a sophisticated scientific based magazine on the topic of farming and poverty. As the problem of world hunger becomes more and more apparent I wanted to write an article for what I believe is the solution to the problem. My aim was to inform and persuade the readers to agree with my view that intensive farming is better than free range farming. By all means, there were restrictions and bias to my argument, so in the end I decided to make it a one sided piece. I intended my article for a more sophisticated audience who will have at least some knowledge on the topic of poverty and farming. However, I knew that I would cause disagreements with the readers as people have†¦show more content†¦The reader may be convinced to think that the article is written by an expert on the subject, so, it may encourage the reader to agree with me. However, my article argues strongly for one side of the argument; my view is against those of the general public, most of which have a false belief that free range products are better than intensive. Therefore, to support my point I included a large photograph showing the vile conditions in a free range farm. Using this may help me to get the reader on my side. I chose this specific picture because it demonstrates a wide variety of senses; you can almost smell the overwhelming stench of the faeces and hear the deafening cluck of a thousand chickens. The right side of the picture is very dark compared to the left, this could suggest to the reader that there are dark sides to free range farming as well as the bright side that is often advertised. The light at the end of the farm also makes the farm seem endless, and therefore, it would seem as if there were millions of chickens all crammed into the cages. This may encourage the reader to dislike free range farming and more likely to support my view. I knew that the introduction had to be important; I tried to make it as engaging, appealing and shocking as I could. In order to engage my readers, I started the article with two rhetorical question asking the reader for their opinions on the picture. One of which is: â€Å"What do you think this picture shows?†, the use of personal

Wednesday, May 6, 2020

Essay about Everyone Deserves a Second Chance - 980 Words

Attending Samford University as a freshman, I was more than positive that all of my classes would be boring until I enrolled in Communication Arts 101. Communication Arts is a class required for all freshmen to take and it helps develop writing and speaking skills that will empower us as students. Traditionally, college professors will ask their students to write an essay and move on to the next assignment. In contrast, Samford University incorporates formal speeches into the curriculum to help students vocally express their research and thoughts. Our class was recently assigned to deliver an Informative speech, which is a major portion of our grade. My speech received a fairly good grade; however, there are some aspects of my speech that†¦show more content†¦The second weakness I observed in my Informative speech was my lack of commanding the material. While I was delivering my speech, I continuously read my notes cards verbatim instead of paraphrasing my information to mak e my speech sound fluent. There were many accounts where I constantly made this mistake of reading my note cards verbatim. For instance, this occurred when I alleged, â€Å"Social Media Networking is the process in which society use social media to promote businesses and communicate with friends and family.† When I read this statement from my note cards verbatim, it showed my audience my lack of mastery over the material. The audience may become uninterested and unreceptive when the presenter reads from their notes too often. This weakness can also cause the presenter to makes less eye-contact with the audience. Even though my eye-contact was decent throughout the speech, I continuously stared at my note cards which caused the attention of my audience to drift away. In order for this not to reoccur, I simply need to practice more. I know this may sound broad, but the more I practice my speech the less I will depend on my note cards to get me through the presentation. Hencefor th, I stood in the mirror for numerous hours imagining the mirror was my audience. I envisioned my classmates in front of me as I assimilated gestures and constant eye-contact to engage my audience. When I deliver my Revision speech, my audience willShow MoreRelatedCapital Punishment : A Hot Topic On The Public Eye996 Words   |  4 PagesCapital Punishment has been a hot topic in the public eye for some time. The question on many minds is whether it is acceptable for the state to end one’s life for the crime they have committed. I believe that everyone deserves a second chance. Another issue that we should address is, that in the justice system on daily basis we will encounter mistakes being made. With that said, if an innocent was executed, there is no way for the system to redeem itself, there is no way for that person to be broughtRead MoreJuveniles Being Tried as Adults1328 Words   |  6 Pagesthe past 30 years or so, the idea of a juvenile or teenager being tried as an adult has been a very controversial issue. When a juvenile commits a very heinous crime, many believe that that youth deserves to be tried as an adult, and given a full sentence. Some even believe that these juveniles deserve to go to adult prison. When a child kills, does he instantly become an adult? Or does he maintain some trappings of childhood, despite the gravity of his actions? (Reaves Para 1). What draws theRead MoreGiving People A Second Chance By Ernest Martinez905 Words   |  4 PagesIn Ernest Martinez’s article, â€Å"Giving People a Second Chance,† he express his thought towards Hispanic ex-convicts. Martinez believes that once ex-convicts do their time in prison, they should be given an equal opportunity to find quality work just as those who were never in prison. He writes that society tends to neglect â€Å"Hispanic brethren who are ex-convicts who need employment avenues for re-entry into society.† Martinez’s main point is that, ev en individuals who decide to make wrong decisionsRead MorePunishment Fails, Rehabilitation Works As defined in the dictionary, rehabilitation is the process600 Words   |  3 Pagesof punishment depends on the crime committed. For example, if someone stole an article of clothing from a store, the punishment would be much different than if another person decided to kill their neighbor. Personally, I believe that everyone deserves a second chance to get their life back. Humans are only put on this world once, and they need to make the best of it – even if they commit an awful crime. In Romans 2:1, the Bible states that â€Å"You, therefore, have no excuse, you who pass judgment onRead MoreDeath Penalty : Analyzing The Capital Punishment s Statistical Effects And Harms1199 Words   |  5 Pagesthem. This guilt makes them feel as if they deserve this punishment. The truth is they do not deserve it. No human being in this world deserves that punishment. They deserve a second chance. They deserve a glimmer of hope in their life that makes them strive to do better. The death penalty kills their hope. It takes their hope and annihilates it, leaving no traces behind. The death penalty is a punishment that should never be used because no person deserves to be killed for their actions, and it hasRead MoreRespect And Respect Of Respect1094 Words   |  5 Pagesusually comes from the qualities, abilities, or achievements of whatever or whoever you respect. Respect is something worked up to. However, even though respect is something that is completely intangible, it is something that is extremely sought after. Everyone wants the respect of someone. It could be a parent, a friend, a teacher, a boss, or many other countless possibilities. No matter why you want it or who you want it from, it is going to take some hard work to gain something as valuable as someone’sRead MoreAdvantages And Disadvantages Of Juveniles1016 Words   |  5 Pagesshould be treated differently than an adult who commit the same crime, but that’s not what’s happenin g today. Young children are not the same as an adult in many ways, so they should not be put in jail for life if they commit a crime. Nobody really deserve to be put into a jail for the rest of their life, especially a young kid. It is injustice to sentenced juveniles, who committed murder, a life to prison because it violate the rights that were given to all of us. All people experienced or experiencingRead MoreTo Kill a Mockingbird by Harper Lee663 Words   |  3 Pagesautomatically seen as guilty. When Atticus was chosen to defend Tom Robinson many of the people in the community took it upon themselves to pay him a visit. It was understood by everyone that Tom had no chance and some of the men in the county went to Atticus to see if he would drop the case. Atticus knows though that Tom is innocent and deserves to have a fair trial. â€Å"Link, that boy might go to the chair, but he’s not going until the truth’s told† (Lee 146) . Atticus demands justice no matter who it is or whatRead MoreJuvenile Prisons And Its Effects On Youth1204 Words   |  5 Pagesofficials should give them a second chance. Miracles always happen when granted a second chance. Second chances should not be given to everyone but to the ones that deserve to have a second chance. If a teen, for instance had to steal money for food or something very im portant, when caught he should not be remanded but given another chance. This would help the juvenile because when granted a second chance, he or she would not repeat the same mistake again. Second chances can also be dangerous becauseRead MoreKendall Le1. Roskos, Ela 1St. 3/20/17. Living Life With1504 Words   |  7 Pagesmaybe even more classes once they are out of prison, they can be qualified to get a job and be productive citizens. All human life has value no matter what he/she did. Capital punishment is inhuman no matter what. There are multiple reasons why everyone should be against capital punishment. One reason is that many innocent lives have been lost because someone didn’t have a good lawyer, or they got blamed for something and couldn’t defend for themselves, â€Å"innocent men and women have been released

Tuesday, May 5, 2020

Storyteller free essay sample

Cue stage lights: A man and woman are sitting on opposite sides of a table, his face hidden behind a newspaper and hers behind a book. They do not speak, but I am already running through the conversations they will soon have and the words that will be left hanging in the air. When the dialogue begins, I lean back in my chair and become an audience to my own work. This is my play being performed on an Off-Broadway stage in New York during Writopia’s 2013 Worldwide Plays Festival. These are the words that I typed on my computer and scribbled on post-its and assorted pages every chance I had. This is the result of a year-long effort of collaborative thoughts, revisions, and drafts. I have played these scenes in my mind hundreds of times, searching for improvements. And now I have been placed in the ultimate workshop setting: a sold-out theater. We will write a custom essay sample on Storyteller or any similar topic specifically for you Do Not WasteYour Time HIRE WRITER Only 13.90 / page As I watch the actors move across the stage, I make a mental note of the audience’s reaction to every moment. I sigh when the female character speaks one line incorrectly, but now appreciate the numerous times directors have told me never to tamper with the playwright’s dialogue when I am acting onstage. I soak in the subtle reactions of the people around me and smile to myself as I think about the fact that, as the audience takes in my play, they are unknowingly learning all about my life, my playwriting process, and my quest to be a storyteller from the time I was old enough to sit up and construct scenes and dialogue with my Winnie-the-Pooh figurines. If only, as the audience listensto my play’s female character discuss her fascination with Daphne du Maurier’s novel Rebecca, they could picture me in my pitch-black bedroom, holding a flashlight to the book as I read the final pages, desperately racing to the end, while wishing the story could go on forever. Then, as the characters’ emotions heighten and the atmosphere becomes tense, they could imagine me doodling images of my characters into my idea notebook, basing their facial and body expressions on those I had noticed on different people throughout the day. Or they could watch me suddenly waking up at three in the morning, grabbing my notebook to record a dream about the fate of the two characters before it escaped my thoughts. And then they could picture me at museums, on the subway, or walking through Central Park, listening to conversations to gain further inspiration. And, once my play is over, I wish, as a coda, the audience could see my friends and siblings acting with me in all the plays I had written over the years, pretending we were Broadway stars as we reveled in our ever-present laughter and I hung on to each word we spoke to be sure it sounded exactly right. Then the audience might really know who this playwright, this storyteller, really is. As my play nears its end, a man and woman are standing by an open window, overlooking a fire escape. The woman kisses the man on the cheek, and, in an act of defiance reminiscent of Ibsen’s Nora, she climbs out the window and walks down the fire escape. As the audience applauds, I think about the characters I have created, and, as I have done throughout my life, I naturally start thinking about where my characters will go next, where I will go next. I write to tell stories. By writing, I am learning about myself and the world around me. I live a life filled with new events waiting to happen, compelling people to meet, exciting places to see, and new adventures to incorporate into my tales. This is my play. This is my life. This is who I am. Cue blackout.

Friday, April 17, 2020

Wolf Predation Essays - Predation, LotkaVolterra Equations, Caribou

Wolf Predation Effects of Wolf Predation Abstract: This paper discusses four hypotheses to explain the effects of wolf predation on prey populations of large ungulates. The four proposed hypotheses examined are the predation limiting hypothesis, the predation regulating hypothesis, the predator pit hypothesis, and the stable limit cycle hypothesis. There is much research literature that discusses how these hypotheses can be used to interpret various data sets obtained from field studies. It was concluded that the predation limiting hypothesis fit most study cases, but that more research is necessary to account for multiple predator - multiple prey relationships. The effects of predation can have an enormous impact on the ecological organization and structure of communities. The processes of predation affect virtually every species to some degree or another. Predation can be defined as when members of one species eat (and/or kill) those of another species. The specific type of predation between wolves and large ungulates involves carnivores preying on herbivores. Predation can have many possible effects on the interrelations of populations. To draw any correlations between the effects of these predator-prey interactions requires studies of a long duration, and statistical analysis of large data sets representative of the populations as a whole. Predation could limit the prey distribution and decrease abundance. Such limitation may be desirable in the case of pest species, or undesirable to some individuals as with game animals or endangered species. Predation may also act as a major selective force. The effects of predator prey coevolution can explain many evolutionary adaptations in both predator and prey species. The effects of wolf predation on species of large ungulates have proven to be controversial and elusive. There have been many different models proposed to describe the processes operating on populations influenced by wolf predation. Some of the proposed mechanisms include the predation limiting hypothesis, the predation regulating hypothesis, the predator pit hypothesis, and the stable limit cycle hypothesis (Boutin 1992). The purpose of this paper is to assess the empirical data on population dynamics and attempt to determine if one of the four hypotheses is a better model of the effects of wolf predation on ungulate population densities. The predation limiting hypothesis proposes that predation is the primary factor that limits prey density. In this non- equilibrium model recurrent fluctuations occur in the prey population. This implies that the prey population does not return to some particular equilibrium after deviation. The predation limiting hypothesis involves a density independent mechanism. The mechanism might apply to one prey - one predator systems (Boutin 1992). This hypothesis predicts that losses of prey due to predation will be large enough to halt prey population increase. Many studies support the hypothesis that predation limits prey density. Bergerud et al. (1983) concluded from their study of the interrelations of wolves and moose in the Pukaskwa National Park that wolf predation limited, and may have caused a decline in, the moose population, and that if wolves were eliminated, the moose population would increase until limited by some other regulatory factor, such as food availability. However, they go on to point out that this upper limit will not be sustainable, but will eventually lead to resource depletion and population decline. Seip (1992) found that high wolf predation on caribou in the Quesnel Lake area resulted in a decline in the population, while low wolf predation in the Wells Gray Provincial Park resulted in a slowly increasing population. Wolf predation at the Quesnel Lake area remained high despite a fifty percent decline in the caribou population, indicating that mortality due to predation was not density-dependent within this range of population densities. Dale et al. (1994), in their study of wolves and caribou in Gates National Park and Preserve, showed that wolf predation can be an important limiting factor at low caribou population densities, and may have an anti-regulatory effect. They also state that wolf predation may affect the distribution and abundance of caribou populations. Bergerud and Ballard (1988), in their interpretation of the Nelchina caribou herd case history, said that during and immediately following a reduction in the wolf population, calf recruitment increased, which should result in a future caribou population increase. Gasaway et al. (1983) also indicated that wolf predation can sufficiently increase

Friday, March 13, 2020

United States and Essential Questions Essay

United States and Essential Questions Essay United States and Essential Questions Essay Advanced Placement Untied States History Dr. Alba 2014-2015 School Year Course Description: AP U.S. History covers the spectrum of American history from pre- Columbian days to the present. Using chronological and thematic approaches to the material, the course exposes students to extensive primary and secondary sources and to the interpretations of various historians. Class participation through seminar reports, discussions, debates, and role-playing activities is required; special emphasis is placed on critical reading and essay writing to help students prepare for the AP examination. The course is structured chronologically, divided into 21 units. Each unit includes one or more of the nine periods and/or key concepts outlined in the AP U.S. History curriculum framework. Key Themes: The course is structured both chronologically and thematically. The themes include: Identity, Work, Exchange and Technology, Peopling, Politics and Power, America in the World, Environment and Geography, and Ideas, Beliefs, and Culture. Elements of these themes are included in most unit assignments. Skills Developed: In each unit, students will get practice developing the following content-driven skills: Crafting Historical Arguments from Historical Evidence (including Historical Argumentation and Appropriate Use of Relevant Historical Evidence), Chronological Reasoning (including Historical Causation, Patterns of Continuity and Change over Time, and Periodization), Comparison and Contextualization, and Historical Interpretation and Synthesis. In addition, class activities and assignments will address the following academic skills: Reading for comprehension and recall, improving study skills in preparation for assessments, improving formal writing skills (addressed below), improving public speaking skills in class discussions and activities, and improving skills of map reading and interpretation. Writing Focus: Historical work at a collegiate level requires students to write proficiently. For this reason, writing is emphasized in every unit of this course. Students receive â€Å"essential questions† to frame class discussions; these are often used as writing assignments. Assessment of essays are measured by the following: the degree to which they fully and directly answer the question, the strength of thesis statement, level and effectiveness of analysis, amount and quality of supporting evidence, and organizational quality. In addition to these standards, DBQs are graded on the basis of the degree to which a significant number of the documents have been used to support the thesis, and the amount and quality of outside information included in the response. Course Texts: Textbook: Brinkley, Alan. American History Connecting with the Past [CR1a] Supplemental Texts: [CR1c] Heffner, Richard D. A Documentary History of the United States, (2013) Zinn, Howard. A People’s History of the United States (2010 ed.) New York, New York: Harper Collins. SoRelle, James and Madaras, Larry. Taking Sides (15th Edition) Volume 1 and Volume 2 Chang, Iris .The Chinese in America (2003) Penguin Books, USA Loewen, James. Lies My Teacher Told Me New York, New York Various Others Readings UNIT 1: SETTLEMENT AND EXPANSION OF COLONIAL AMERICA [CR2] Texts and other materials utilized: Connecting with the Past Chapters 1-3, Taking Sides Unit 1, and A People’s History of the United States, Chapters 1-3. Lies My teacher Told Me Chapter 1-4 [CR1b] Themes: ID, WXT, PEO, POL, WOR, ENV Major Topics: Early contacts among groups in North America, and North American societies in the context of the Atlantic World; Spanish exploration and the development of colonies in the Americas; the rise of the English as an imperial power, including the conflict with the Spanish; initial English colonial settlements, including successes and failures, and the unique attributes of each of the colonies; the evolution of

Wednesday, February 26, 2020

To Investigate How iPhone Maker Apple Competes across the Smartphone Essay

To Investigate How iPhone Maker Apple Competes across the Smartphone Market - Essay Example There are many iconic products in the world, but few have had the power and impact that has been witnessed in the iPhone. The way in which Apple creates a mythology about its brands and the effect that this mythology has upon the perception of the products made by Apple is of great interest. Many companies would want to mimic or surpass this type of powerful branding. Therefore, studying the way in which the product has been marketed to the public is a powerful tool for understanding how such a phenomenon can occur. 4. Research Design Two types of data contribute to the further understanding of the topic of this research study. Primary and secondary researches were explored in order to more fully understand the objectives of the study as they have been framed by the research questions. Primary data was determined through the use of a questionnaire that would be distributed to appropriate participants. The secondary data was taken from resources that have information that would add pe rspective to the topic of this study. This data was taken from internet resources as well as books and journal articles. The secondary research was conducted through the lens of exploratory research, defined by Beri (2008) as creating a focus on ideas that pertain to the concepts within the study. In researching the previously established concepts that pertain to the topic, new ideas can be generated towards discovering new aspects to the study. The data was approached through the grounded theory for qualitative research. The research was coded for its commonalities from which memos will be created in order to organize the discovery into concepts that can be analyzed for their content. In comparing the contents of the research, a hypothesis will then be considered as it is revealed through the data. Although this methodology seems backwards, it provides for the emergence of themes, rather than forcing a preconceived idea and then seeking data to prove or disprove the concept (Straus s 1999, p. vii). 5. Research Resources Analysis The research methodology is essentially qualitative in nature. It does not involve a statistical analysis of the success rate of the marketing campaign of Apple for iPhone. The research is focused on the qualitative understanding of the marketing technique employed by Apple and the effectiveness of this technique expressed in terms of customer feedback and views, and the level of customer satisfaction. To this end, the resources utilized would be in the form of questionnaires sent via email, and filled out in person by customers selected randomly in a marketplace. The second part of the study involves a review of the existing research on the topic through the examination of published journals and articles. Through a cognitive analysis of results obtained from this two-pronged study, and comparison of the established and new research on the subject, a conclusion would be drawn about the marketing methodology and its effectiveness of App le for iPhone. The questionnaires designed for this purpose will have to be open-ended so that they present flexibility to the volunteers to fully express their views. Questions that reflect preconceived ideas about the marketing strategy will be discarded. To this end, a list of all the possible questions will be prepared, from which only

Sunday, February 9, 2020

BUSINESS ANALYTICS METHOD AND SOFTWARE Coursework

BUSINESS ANALYTICS METHOD AND SOFTWARE - Coursework Example Setting up complex statistical analyses on large data without prior identification of the objectives and knowhow about the suitability and possible outcome of the proposed analyses often renders misleading results. According to Albert Einstein, â€Å"the formulation of a problem is often more essential than its solution which may be merely a matter of mathematical or experimental skill† (Faraway, 2002). This report aims to explore the utility of statistical software such as R and gain insights into the statistical methods such as multivariate analysis of variance (MANOVA) with as well as without regard to each other. The report will provide with a comprehensive overview of the R software, its advantages and disadvantages, current market trends in the software category and reflect hands-on experience gained by its use. Next, the report will provide with a comprehensive overview of MANOVA, and advantages and disadvantages associated with it. Finally, the report will include a st ep-by-step description on the implementation of MANOVA in R, followed by the conclusions. R is a computer scripting language and an interactive software environment designed particularly for statistical analyses, manipulation and visualization of data and results (Seefeld, 2007; Venables et al., 2008). The name, R, was used by Robert Gentleman and Ross Ihaka, while creating the R project at the Department of Statistics, University of Auckland, in 1995 (Owen, 2010). The language was mostly derived from two existing languages, S and Scheme, developed in 1985 and 1975, respectively. While addressing the issues involved in the design and implementation of these languages for statistical computing, the authors considered combining their strengths to produce another language. The resulting language, R, largely resembles S but is based on semantics and

Thursday, January 30, 2020

A glimpse of Big Data Essay Example for Free

A glimpse of Big Data Essay â€Å"Big data is not a precise term; rather its a characterization of the never ending accumulation of all kinds of data, most of it unstructured. It describes data sets that are growing exponentially and that are too large, too raw or too unstructured for analysis using relational database techniques. Whether terabytes or petabytes, the precise amount is less the issue than where the data ends up and how it is used.†Cite from EMC’s report â€Å"Big data: Big opportunity to create business value†. When explosion happened in mobile network, cloud computing and internet technology, more and more different information appeared. In the past, the numerous terabyte data could be a disaster for any company, because it means high cost of storage and high performance CPU. However, in nowadays, companies discovered many facts they haven’t thought about these data before. Companies started to use data analytics technology to find business values from these terabyte or petabyte data. It seems to be a big opportunity instead of disaster for companies now. Data is not only defined as structured data. When we talking about big data, it could be categorized into three types of data: structured data, unstructured data, and semistructured data (Please see Chart I). Especially when internet and mobile internet developed rapidly, the unstructured data and semistructured data exploded. For example, a bank could draw a conclusion by analyze unstructured data to find out why number of churn increased. Most definitions of big data all talk about the size of data. However, size, or volume, is not the only characteristic of big data. There are other two characteristics, variety and velocity. Variety means big data generates from several of sources. Data type was no longer connected to structured data. According to the EMC’s report, most of big data related to unstructured data. Velocity means the speed of data production. Data was no long structured data which was stored in the structured database. Data could come from anywhere and anytime: mobile, censors, devices, manufacturing machine etc. The stream of data generates in real time. This means company’s action should be taken with this speed. Structured data| Structured data is organized in structure. These data can be read and stored by computer. The form of structured data is structured data base that store specific data by methodology of columns and rows. | Unstructured data| Unstructured data refers to the data without identified structure. For example, video, audio, picture, text and so on. These data also called loosely structured data. | Semistructured data| Semistructured data organized in semantic entities. The data’s size and type in one group could be different. For example, XML and RSS feeds. This data try to reconcile the real world with computer based database.| Chart I. Three types of data. Big data analytics Big data analytics is not a technique. It is a terms that contains a lot of technologies (See EXHIBITION I). Based on enterprise’s different requirement, each program will use different technology to analyze data. However, with the big data’s development, some of these techniques become popular and useful. On the basis of the exhibition II, advanced analytics, visualization, real time, in-memory databases and unstructured data have strong-to-moderate commitment and strong potential growth. The traditional techniques, for example, OLAP tools and hand-coded SQL, have gradually lost their place. When a bank want to find the reason why the number of customer churn increased, or marketing department decide to push precise advertisement to their customer, they need to analyze customer behavior. These data from customer service emails, phone call records, sales interview reports, login data from mobile devices, and so on. Almost all of these data cannot be analyzed by traditional data analytic techniques. That’s why these new techniques development so rapid and fierce. How a company adopt big data analytics? According to the article Big Data, Analytics and the Path from Insights to Value† published on MIT Sloan Management Review, the author categorized the company who used big data analytics into three stages (See Exhibition II). For most companies, it is easy to establish an enterprise data warehouses (EDW’s). However, how to interpret these data and finding the business value from these data become the most crucial factor for companies. Besides, so many techniques and tools behind the term big data. For any company who decide to adopt big data analytics, the leading obstacle is lacking of understanding of how to use analytics to improve their business. From the article, the author gave 5 recommendation to any company who wanted to adopt big data analytics. 1. Think Big. Focus on the biggest and highest value opportunities. Narrow down the options. 2. Start in the Middle. Within each opportunity, start with questions, not data. Company prefer to collect data and information at first place. In fact, start with questions could help company continue to narrow down the scope and define the most valuable direction. 3. Make analytics come alive. When Problem was defined, company need to apply analytics. Choosing the propriety tools to analyze the data. 4. Add, dong detract. Use centralized analytics. Every analysis is connected. 5. Build the parts, plan the whole. Big data from everywhere. The data will become more and more big and complex. Building the data infrastructure is crucial for big data analytics. Big Data, Big Opportunity When company decide to concern big data, it means every department are involved. Big data is not IT department’s or analysts’ responsibility. In fact, big data analytics need information and help from sales, marketing, RD, IT and even external sources. Today, number of companies have entered into big data market. The following chart lists some big organizations who have adopted big data analytics. Besides, some of them provide big data services to other companies These organizations are just the tip of the iceberg. When big data converted from Blue Ocean to Red Ocean, some of these organizations have turned into services provider. This become a future trend in big data area. Big data needs expensive hardware and labor cost. Not every company can afford that. Besides, big data involved so many different computer technologies, not everyone understood all these techniques. For that matter, there will be more and more companies try to seek big data service from external environment. Using the external big data platform or tools could reduce the cost for building a totally new technique teams. What the companies need to do is finding the problem, narrow down the scope and sending the needs to services provider. When they get the analysis result, they could use the valued result to take the next action. Furthermore, these services provider will not only focus on big companies. The new fashion is to provide friendly interface and easy to use product to individual customer. What behind big data will be still mystery for people, however, the face or terminal of big data will become more and more friendly and simple. There is an example: Twithink. Twithink is a program invented by a MIT group. They provide customized twitter behavior analysis for customer. This program could draw some conclusion by analysis the unstructured information on Twitter. They collected the gender, location, time, key words, images, etc. from tweets. Then they analysis these data under certain arithmetic to draw conclusions. The last research was the Election in 2012. The latest research is Gun Control discussion which still in progress. Problem and threats. Although big data has many opportunity and advantage for enterprises, it still has some disadvantages. The first crucial problem is privacy invasion. After you searched one product on Amazon, the next time when you login to Amazon, you will find the products you may interested which was Amazon pushed to you. This is called precise advertisement. However, you even didn’t know when amazon collected your information. Another example was Google Analyst, company embedded code into their website to collect people’s internet behavior. These things happened every day and everywhere. It is hard to argue this action is right or wrong. Maybe some are good. However, if personal data is sold or published by someone, it will affect individual’s daily life. It will become a crucial problem. The Second problem is information’s validity. According to the article â€Å"With big data comes big responsibilities† points out that â€Å"big data sets are never complete†. If data is insufficient, the analysis result would be invalid or distorted. The invalid information would guide company to wrong direction and cause a big loss. Thus, big data also has two side. How to use it to create more value for company is the first consideration for all managers. Reference 1. Office 2013 Brings BI, Big Data to Windows 8 Tablets. ZDNet. N.p., n.d. Web. 25 Jan. 2013. 2. Big Recognition for IBM Big Data. Smarter Computing Blog Big Recognition for IBM Big Data Comments. N.p., n.d. Web. 25 Jan. 2013. 3. Big Data. Wikipedia. Wikimedia Foundation, 26 Jan. 2013. Web. 26 Jan. 2013. 4. Structured Data. Webopedia. N.p., n.d. Web. 26 Jan. 2013. 5. Unstructured Data. Webopedia. N.p., n.d. Web. 26 Jan. 2013. 6. Group of EMC. Big Data: Big Opportunities to Create Business Value. Rep. EMC, n.d. Web. 26 Jan. 2013. 7. Philip Russom. Big Data Analytics. N.p.: TDWI, 2011. Print. 8. Lavalle, Steve. Big Data, Analytics and the Path from Insights to Value. MIT Sloan Management Review Winter 2011: 21-31. Web. 9. Ã¥ ¤ §Ã¦â€¢ °Ã¦  ®Ã¥ · ²Ã¦Ë† Ã§ º ¢Ã¦ µ ·Ã¯ ¼Å¸Ã¯ ¼ Ã¥â€¦ ¨Ã§ Æ'Ã¥  Ã¥â€ºâ€ºÃ¤ ¸ ªÃ¥ ¤ §Ã¦â€¢ °Ã¦  ®Ã¥â€¦ ¬Ã¥  ¸Ã¥â€¦ ¨Ã©  ¢Ã§â€ºËœÃ§â€š ¹Ã¯ ¼ . N.p., n.d. Web. 26 Jan. 2013. 10. IBM InfoSphere Platform Big Data, Information Integration, Data Warehousing, Ma ster Data Management, Lifecycle Management Data Security. IBM InfoSphere Platform Big Data, Information Integration, Data Warehousing, Master Data Management, Lifecycle Management Data Security. N.p., n.d. Web. 26 Jan. 2013. 11. Amazon Web Services, Cloud Computing: Compute, Storage, Database. Amazon Web Services, Cloud Computing: Compute, Storage, Database. N.p., n.d. Web. 26 Jan. 2013. 12. Oracle Big Data Appliance. Oracle Big Data Appliance. N.p., n.d. Web. 26 Jan. 2013. 13. Google BigQuery Feedback on This Document. Google BigQuery. N.p., n.d. Web. 26 Jan. 2013. 14. EMC Greenplum Data Computing Appliance Data Warehousing, Data Analytics (FW).EMC Greenplum Data Computing Appliance Data Warehousing, Data Analytics (FW). N.p., n.d. Web. 26 Jan. 2013. 15. Teradata. Data Appliance, Data Warehouse, Business Intelligence à ¢Ã‚€Â“. N.p., n.d. Web. 26 Jan. 2013. 16. Twithinks. TwiThinks. N.p., n.d. Web. 26 Jan. 2013. 17. Eria Naone. With Big Data Comes Big Responsibilities. N.p.: MIT Technology Review, n.d. 2011.

Wednesday, January 22, 2020

Art Exhibit on Brown vs. Board of Education :: Art Race Segregation

Recreating the Elements Surrounding Brown vs. Board of Education Usually when I imagine an art exhibit I think of giant portraits of historic figures or arrangements of simple geometric shapes, and I am unable to comprehend how their worth exceeds the value of the materials put into them. These exhibits are usually organized to give an impression of the appropriate artist or time period, but the exhibit commemorating the Brown vs. Board of Education decision creates a model of the concepts and ideas surrounding its issues. The very first thing I noticed when visiting this exhibit was the wallpaper surrounding the entryway. This wallpaper consists of black and white portraits of people’s faces surrounded by and overlapped with bright neon stripes. These stripes are illuminated by black lights aimed from the ceilings and make it difficult to tell the race of the people featured. Although it accomplishes this goal quite well, at first glance I really only noticed how it detracts from the exhibit’s overall appearance. The exhibit and the area outside of it have a somewhat calm modern appearance with track lighting and wood floors so the neon wallpaper does not go well with its surroundings whatsoever which is something definitely not expected in an art museum. The main goal of the exhibit is to make race seem irrelevant and indistinguishable. The first example of this I noticed is obviously the wallpaper outside, which seems quite random and bizarre until the rest o f the exhibit is seen. Once inside the exhibit, I immediately figured out the wallpaper’s purpose as dealing with race issues just like the majority of the works in the exhibit. In the middle of the room, there is a large couch aimed towards a projection screen which shows two sets of home movies side by side of a white and black family. These movies feature scenarios such as birthdays, Christmas, and vacations and other scenarios that I could relate to, which are almost identical in each version. By showing the similarities in the private lives of white and black families, this part of the exhibit demonstrates that racial differences do not make people unlike one another.

Tuesday, January 14, 2020

Bio 201 Final Review

Which of the following is most likely to occur when a tumor-suppressor gene is mutated? – The tumor-suppressor gene and resulting protein may lose its function and ability to suppress cell proliferation. Mutations can produce a polypeptide with increased function. – TRUE ________can convert proto-oncogenes into oncogenes. – Nonsense mutations Most human embryos that are aneuploidy – are spontaneously aborted in the first trimester. Horses and donkeys are closely related species that can interbreed. However, the offspring produced are usually sterile and cannot reproduce. What term would best describe the offspring from this mating? alloploid Mitotic cell division is never used by organisms as a means of reproduction. – FALSE Which of the following accurately gives the distribution of phenotypes produced from a cross of purple dwarf pea plants that are heterozygous for flower color and plant height? – 63 purple dwarf; 28 purple tall; 27 white dwarf; 7 white tall A man with pattern baldness and a woman who has no baldness have a son who develops pattern baldness. Their son has a daughter who also develops pattern baldness. They determine that her expression of this trait is not a symptom of a medical condition.If her mother does not have pattern baldness, the daughter's genotype is ________ and her mother's genotype is _____________. – BB, Bb If a pink snapdragon is self-fertilized, the offspring are red, pink, or white. What type of inheritance pattern does flower color exhibit in this example? * incomplete dominance Which of the following organelle(s) has/have a genome separate from the genome in the cell nucleus? – mitochondria and chloroplast The inheritance pattern in which the mother provides gene products to the developing egg cells is called – maternal effects.If a testcross for two different traits produces more nonrecombinant than recombinant offspring, then the alleles for the two traits â €“ are on the same chromosome. An episome is – a plasmid that can integrate into the bacterial genome. Viral genomes must always be excised from the bacterial chromosome before viral components can be produced. – FALSE A bacterial cell must have ___________ in order to transfer portions of its chromosome to another cell. – an F factor What can be inferred from an organism that has undergone a gene knockout? – The GMO is a homozygote and the cloned gene carries a mutation.Which of the following is an example of a clone on the organism level? – identical twins Following treatment with restriction enzymes, what procedure would be used to isolate DNA fragments of different lengths? -gel electrophoresis At what phase of the cell cycle does p53 halt cell division if it senses DNA damage? – G1 Certain types of cancer are caused by viruses. – TRUE Consider a diploid species where n=5. If an individual of this species was found to have 11 chromosomes, it would be categorized as – both aneuploid and trisomic. At the end of meiosis I the cells are haploid and the homologous pairs are in separate cells. A chromosome with the centromere located two-thirds of the distance from its end could be classified as -either submetacentric or acrocentric. A woman comes to your genetic counseling center because she knows that Huntington disease occurs in members of her family. Her paternal grandfather was afflicted, but so far her father shows no symptoms. Her two great-great grandmothers on her father's side were healthy well into their 90s, and one of her great-great grandfathers died of unknown causes at 45.Testing for Huntington disease is extremely expensive, but she is concerned that she may fall victim to this disease and wants to plan her life accordingly. After examining her pedigree you advise her to – get tested because her father could be a carrier. What features of meiosis allow for independent assortment of chromosomes? – random alignment of homologous sister chromatids on the metaphase plate The genomes of mammalian mitochondria contain – All of the items listed are correct. In biparental inheritance, paternal and maternal gametes provide chloroplasts to the zygote. TRUE Paternal inheritance occurs in plants but not animals because animals do not have chloroplasts. – FALSE Horizontal gene transfer occurs when one species of bacteria takes up the DNA of another species that released the DNA when it died. – TRUE Which of the following does not contribute to the infectious ability of prions? – Prion proteins are deposited as aggregates. Baculovirus genomes are 133. 9 kb long and encode over 150 genes. This suggests that – their protein structures are very complex. Why is Taq polymerase required to perform a polymerase chain reaction (PCR)? Taq polymerase is heat stable and can therefore withstand the high temperature steps required of PCR that most other enzymes cannot tolerate. Why is the production of transgenic plants somewhat easier than the production of transgenic animals? – Plant cells are totipotent. Which of the following is an advantage of molecular pharming? – The yield of recombinant proteins in mammalian milk is quite large. Based on the gene and protein sequences that follow, what type of mutation-polypeptide effect has occurred? Normal gene: ATGGCCGGCCCGAAAGAGACC Mutated gene: ATGGCCGGCACCGAAAGAGACCNormal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp – base addition-missense The timing of a mutation during development has negligible effects on the severity of the genetic defect. – FALSE A gene created from the fusion of two gene fragments is considered a – chimeric gene. If a cell contains 20 units of DNA during G2, it will have 40 units of DNA in S. – FALSE In a tetraploid species, a euploid individual would have ___sets of chro mosomes. – 4 For any given species, cells in metaphase II of meiosis would contain 2? more genetic material than cells in metaphase of mitosis. FALSE Which of the following are incorrectly matched for a single-factor cross? – F2 generation / result of P cross A cross of a true-breeding smooth pod and yellow pod plants results in all smooth pod offspring.This indicates that – two of the answers are correct. Yellow and smooth are variants of the same gene, and smooth is the dominant trait. Pea plants cannot self-fertilize because one plant has either ovaries and stamens, but not both. – FALSE A trait that is expressed as a continuum rather than as a few discrete phenotypes is – codominant The genomes of mammalian mitochondria contain All of the items listed are correct. Epigenetic inheritance – can result in the expression of different alleles in different generations. A __________ bacterial cell is able to take up DNA from the environment. â €“ competent Baculovirus genomes are 133. 9 kb long and encode over 150 genes. This suggests that – their protein structures are very complex.Bacteria can exchange DNA between strains of the same species and between different species. – TRUE A researcher wants to clone a specific gene of interest. Why would he/she choose a viral vector for introducing the gene of interest into a host cell? A viral vector can infect living cells and take control of the host cell's metabolic machinery. Which of the following diseases affect DNA repair? – xeroderma pigmentosum Cancers originate from a single cell. – TRUE Consider a cell in which all of the homologous chromosomes experience nondisjunction during meiosis I. What would be the result of this event? – two polyploid gametes Which of the following is not a part of the mitotic spindle apparatus in plants? – centriole A nearsighted woman (Nn) with hazel eyes (Hh) marries a man with normal vision and hazel eyes (Hh). Their three children all have blue eyes and normal vision.What is the probability that their next child will have blue eyes and be nearsighted? – 3/8 How can you determine the genotype of a plant showing the dominant phenotype of red color? – Cross the red plant with a white plant to see if any white plants appear. When some recessive human diseases are present in the heterozygous state, incomplete dominance occurs. – TRUE In the sweet pea crossing experiment by Bateson and Punnet, the F2 generation had many more offspring with the phenotypes of purple flowers P, long pollen L and red flowers p, round pollen l than expected from independent assortment.This is because – All of the statements given are true. Quantitative traits – are correctly described by all of these statements. You breed a black, long-haired rabbit with a white, short-haired rabbit. All of the offspring have long, black hair. If the genes for hair color and lengt h are linked, what would be a possible ratio for the F2 population? | – 5 long-haired black, 4 short-haired white, 1 short-haired black, 2 long-haired white Bacteria can exchange DNA between strains of the same species and between different species. – TRUEA particle that consists of nucleic acids surrounded by protein and requires a host organism to replicate is – a prion It has been difficult to create an effective vaccine against HIV because reverse transcriptase cannot correct its errors. – TRUE Which of the following is a possible use for gene cloning? – All of the choices are correct. Which would be TRUE of comparing the DNA fingerprints from hair samples of identical twins? – Every band matches. What is required for a group of clones to be considered a contig? – The clones should have overlapping regions of DNA.A researcher determined that a strain of E. coli is producing a shortened version of a protein required for glucose met abolism. What type of mutation could be responsible for this shorter than normal protein? – nonsense mutation When cancer cells have the ability to migrate to other parts of the body, they are said to be – metastatic. The process by which haploid cells are produced from diploid cells is called – meiosis In a haploid dominant species – the multicellular organism is haploid and the zygote is diploid. DNA associates very tightly with nucleosomes because negative charges on DNA are attracted to positive charges of the histone proteins. The two-factor crosses performed by Mendel support the observation that – alleles for a given trait are distributed randomly among an individual's gametes independent of the alleles for other traits. A cross between two pea plants produces a population of 732 purple and 268 white plants.What is the genotype and phenotype of the parents that produced this population? – both parents heterozygous purple A couple has five sons. What is the probability that their next child will be a girl? 50% If the recombination frequency between gene A and B is 10 out of 100 offspring, gene A and C is 30 out of 100 offspring, and gene B and C is 40 out of 100 offspring, what is the location of these genes in relation to each other on a chromosome? – either CAB or BAC A modification of a gene or chromosome that occurs during gamete formation or early development which permanently alters the expression of that gene for the lifetime of the individual is called – epigenetic inheritance. A plant cell contains _____ genomes and an animal cell contains ______ genomes. – 3,2Drugs that are HIV protease inhibitors – prevent HIV protease from degrading host cell proteins. Transformation is the transfer of genes from dead bacteria to live bacteria. – TRUE Horizontal gene transfer occurs when one species of bacteria takes up the DNA of another species that released the DNA when it died. à ¢â‚¬â€œ TRUE The entire collection of a species' proteins is known as its – proteome Which of the following pollutants could be reduced with the use of bioremediation? – All of the choices are correct The main goal of polymerase chain reaction (PCR) is to generate many copies of DNA. – TRUEWhat would result from a single nucleotide deletion (point mutation) within the coding sequence of a structural gene? – a frameshift mutation, producing a different amino acid sequence altogether Somatic cell mutations are heritable. – FALSE MAPK and MEK are intracellular signaling proteins that mediate cell division induced by growth factors. When mutations in the normal MAPK and MEK genes result in an abnormally high level of MAPK and MEK activity and increases in the rate of cell division, then the mutated gene is called a(n) – oncogene The formation of the bivalent during meiosis – contributes to the genetic diversity of a species.A male is hete rozygous for the trait that produces freckles on the skin, and he has freckles. If he marries a woman who is also heterozygous for freckles, ______ percent of their children will be freckled and __________ percent of their children will be heterozygous. – 75% freckled, 50% heterozygous A person with blood type O can donate blood to people of any blood type. – TRUE Epistatic gene interactions do not follow Mendel's laws of inheritance. – FALSE Which of the following statements correctly describes a quantitative trait? – People who are homozygous for the group of genes associated with skin igment have either lighter or darker skin than those who are heterozygous for those genes. The donor cell makes ___________ whose function is to bring F- cells close enough to transfer a ___________ to the recipient. – a sex pilus, single strand of DNA Integrase – cuts the viral genome and is required for both prophage and provirus formation.Which of the fol lowing is an advantage of cDNA libraries? – cDNA lacks introns and therefore reflects all the genes expressed by a particular tissue or organism. What is it called when a cloned gene recombines with the normal gene on a chromosome to create a genetically modified organism (GMO)? gene replacement p53 is a tumor suppressor gene that acts as a sensor of DNA damage – TRUE The movement of DNA polymerase continues unimpeded if a thymine dimer is present in the DNA double helix. – FALSE In mammals, males are ________ and females are ____________. – hemizygous, homozygous An organism that is heterozygous for two traits can produce a maximum of _______ different gametes for these traits. – 4 In plants, most chloroplasts are inherited from the maternal plant because maternal gametes contribute the most __________ to the zygote. – cytoplasm Place the following events of bacterial transformation in order from first to last. – DNA replication b â €“ an enzyme joins F factor DNA ends c – sex pilus shortens d – DNA transfer e – an enzyme cuts F factor DNA -c, e, d, b, a Which of the following acts as a carrier of foreign DNA and is needed to clone a gene? – plasmid and viral vectorWhich of the following statements is TRUE of restriction enzymes? – They protect bacterial cells from invasion by foreign DNA. Which of the following types of physical mutagens produces thymine dimer mutations? -ultraviolet light Which of the following would occur from a mutation in the gene's promoter region? -The rate of transcription may increase or decrease.Which of the following is an overgrowth of cells that serves no useful purpose? – tumor The karyotype of a normal human male would show a total of 23 pairs of homologous chromosomes. -FALSE Meiosis I produces __________, and meiosis II produces _________ cells. – two haploid, 4 haploid Which of the following mutations will not alter the amou nt of genetic material on the chromosomes? -inversion You discover a new sunflower that has blue flowers instead of yellow. When you cross this blue variety with a common yellow variety you get blue and yellow speckled flowers. What type of inheritance pattern does this gene exhibit? codominance A person with blood type O can donate blood to people of any blood type. – TRUE The sex of all animals is determined by chromosomes. – FALSE Albinism in most animals is an epistatic trait characterized by a lack of melanin pigment in the eyes, skin, and hair. If the allele for albinism is a, the allele for brown coat color is B, and the allele for red coat color is b, which of the following genotypes would result in an albino cow? -aaBB and aabb Bacterial cells only contain one copy of its circular chromosome. -FALSE When a virus has a broad host range, -it can infect many cell types or species.A researcher wants to introduce the human gene encoding tissue plasminogen activator (used to dissolve blood clots) into a mammal so that the protein will be secreted into the milk of the mammary gland. What is required for the researcher's success? -The gene should be placed next to the promoter of a gene that is expressed in mammary cells. The main goal of polymerase chain reaction (PCR) is to generate many copies of DNA. -TRUE Sickle-cell anemia is a human disease that occurs as a result of what type of mutation in the ? -globin gene? – missense Which of the following statements about cancer is FALSE? Most cancers involve genetic changes that are passed from parent to offspring. G banding can be used to detect genetic mutations. -TRUE Two babies are mixed up in the hospital nursery. The blood types of Couple 1 are A and O and the blood types of Couple 2 are AB and B. Baby Joe has blood type O and Baby Jane has blood type A. Who are the parents of Baby Joe and Baby Jane? – Couple 1, Baby Joe or Baby Jane; Couple 2, Baby Jane The single-factor crosse s performed by Mendel support the observation that – the two alleles for a given gene are distributed randomly among an individual's gametes.Genomic imprinting can result in offspring with identical genotypes that have different phenotypes. -TRUE In biparental inheritance, paternal and maternal gametes provide chloroplasts to the zygote. -TRUE The two daughter cells that are formed as a result of binary fission – All of these statements are correct. The chromosome must be ___________ in order to fit into the bacterial cell. – supercoiled by topisomerases Which of the following statements about genomic libraries and cDNA libraries is TRUE? – A cDNA library is derived from mRNA and is made using reverse transcriptase.Bioremediation utilizes newly developed synthetic chemicals to decrease pollution in the environment. -FALSE What type of gene mutation occurred to produce the following protein sequence? Normal: JAYBIRDCATPAW Mutated: JAYBIRDCATPAW -nonsense S hould a genetic abnormality arise, ________ prevent a cell from progressing uncontrollably through the cell cycle. – checkpoint proteins In mitosis, the main difference between plant and animal cells is that – plants produce a cell plate to segregate the daughter nuclei, while animals form a cleavage furrow. Color blindness is a recessive X-linked trait.A normal couple has a color-blind child. Who else in this family is probably color blind? – the child's maternal grandfather The DNA methylation state of a zygote will be maintained throughout the life of the organism and then passed on unchanged to its offspring. -FALSE The bacterial genetic material is -localized to a nucleoid region. Which of the following is true concerning a somatic cell mutation? – Only a small group of cells within the organism is affected by the mutation. A repair enzyme recognizes an incorrect structure in the DNA and directly converts it back to a correct structure.Which of the f ollowing DNA repair systems is responsible for the correction? – direct repair During crossing over in meiosis, an incomplete exchange of genetic material occurs. This would most likely produce – a deficiency in one homologue and a duplication in the other homologue. Height (tallness) in humans is a polygenic trait. Assume the following: There are 4 genes that determine height (Aa, Bb, Cc, Dd). Each dominant allele adds 2 inches of height to an individual. The height of the recessive individual (aa, bb, cc, dd) is 5 feet. What is the height of a person with the genotype (AA, Bb, cc, DD)? – 5? 10?A mutation in the gene encoding the enzyme that cuts F factor DNA during conjugation would result in – an inability to separate the recipient DNA from the donor DNA. A pro- strain of bacteria, which has not been in contact with any other strains, develops the ability to produce the amino acid proline. This mutant â€Å"rescue† could have been caused by â₠¬â€œ addition of the pro+ gene via transduction. Which of the following is true regarding transformed cells that are plated on growth media containing ampicillin? – Each colony began with one antibiotic resistant cell and all cells in the colony are resistant to the antibiotic ampicillin.Which of the following proteins is responsible for advancing a cell through the four phases of the cell cycle? – cyclins If the copy number of a proto-oncogene is increased by gene duplication then the proto-oncogene has undergone – gene amplification. All of the following are chemical mutations EXCEPT – X-rays. Why must the life cycle of sexually reproducing species alternate between haploid and diploid stages? – Meiosis must occur at some point in the life cycle to prevent a doubling of chromosomes in each generation. Which of the following inheritance patterns is matched with an inaccurate molecular basis? Simple Mendelian inheritance; The protein produced by a single allele cannot produce the dominant phenotype. A cell undergoing meiosis that contains sister chromatids may be either haploid or diploid. -TRUE When a single-gene mutation can have phenotypic effects at multiple stages of development, it is – pleiotropic. The karyotype of a young patient shows two Barr bodies per cell. What condition might this child have? – Triple X syndrome Prokaryotes – include bacteria and archea Viroids have a genome but do not translate any of it to protein -TRUEBacterial infections have become much more of a threat to human health due to – All of the events given have increased the threat of bacterial infections. Chromosomes are replicated during the ______ phase. – S Sexual life cycles include both haploid and diploid stages. – TRUE Which of these is NOT a reason that Mendel used pea plants as a model to study inheritance? -They cannot self-fertilize. What is the difference between the blood types, A, B, and O ? -A and B individuals have different modifications made to their carbohydrate tree. O individuals have no modifications made to their carbohydrate tree.If a male cat with orange fur produces female offspring with calico fur, what color was the mother cat? -black or calico Which of the following is not an emerging virus? -Epstein Barr Plasmids can help bacteria grow faster. -TRUE What type of science is a researcher performing if she were conducting experiments to try and map the location of a gene on a particular chromosome? -structural genomics The main goal of polymerase chain reaction (PCR) is to generate many copies of DNA. -TRUE The major way that meiosis II differs from mitosis is that -in meiosis II, the cells are haploid.A person who inherits an extra X chromosome will have -Down syndrome. In humans, having dimples in the cheeks is a dominant trait. If a child has dimples but only one of her parents does, what are the genotypes of her parents? -one parent must be dd, the ot her parent could be either Dd or DD Mating a purebred Labrador retriever to a purebred poodle to produce â€Å"Labradoodles† is an example of -hybridization Barr bodies will -be formed in both males and females, depending on the number of X chromosomes possessed by an individual. Mendel's laws do not adequately explain all the patterns of inheritance. TRUE Viral release from a eukaryotic cell -requires the production of lysozyme encoded by the viral genome and kills the infected cell.Which of the following is NOT added to each of the 4 assay tubes when performing the dideoxy method for DNA sequencing? -DNA polymerase Which of the following is TRUE of short tandem repeat sequences (STRs)? -Their length is variable among different individuals and they can be used for DNA fingerprinting. Under what circumstances would a molecular geneticist need to use a bacterial artificial chromosome (BAC)? when cloning large, eukaryotic genomes One major difference between metaphase I and met aphase II is the presence or absence of bivalents. -TRUE If you were to examine a typical population at a single locus, you would find more copies of the wild-type allele than any other allele. -TRUE In Thomas Hunt Morgan's experiments, the ratio of red-eyed flies to white-eyed flies appeared to follow a simple Mendelian pattern of inheritance.What observation(s) did he make that led to his conclusion that the white-eyed trait was actually not a simple Mendelian trait? He was able to correlate the expression of white eyes to the inheritance of an X chromosome because only F2 males had white eyes and the trait is recessive. After a fragment of DNA containing the gene of interest has been inserted into a vector, how are the gaps between the two pieces of DNA sealed together? -DNA ligase catalyzes the formation of covalent bonds in the DNA backbone. Ionizing radiation can produce which of the following? -free radicals Which protein directs apoptosis? -caspase A horticulturist is breedi ng a new variety of houseplant in which two genes control leaf color.G (allele for green) is dominant to g (yellow) and B (second allele for green) is dominant to b (yellow). The recessive homozygous condition of either gene will mask a dominant allele. What color is a plant with the genotype GgAa? -GREEN You are breeding different varieties of roses in your garden. When you cross a true-breeding yellow â€Å"Texas Beauty† rose with a true-breeding â€Å"Ruby† red rose, you get all red roses. But when you cross a â€Å"Texas Beauty† yellow with the yellow variety â€Å"Jealousy,† you get a 9:7 ratio of red to yellow flowers! What can you conclude from these results? There are epistatic interactions between at least two genes for rose pigment. How does the reproduction of HIV and lambda phage differ? -HIV contains reverse transcriptase enzyme, while lambda phage does not. Offspring receive both the alleles for a given trait from one parent. -FALSEA scienti st has been growing a bacteria strain for some time in culture media containing very few nutrients. The cells are growing slowly, so she enriches the media with amino acids and carbohydrates. To her dismay, instead of growing faster and to higher densities, the bacteria begin to die. What has caused this strange result? The bacteria is infected with a temperate phage, and has switched from the lysogenic cycle to the lytic cycle. If a large protein is run on a gel slab and subjected to electrophoresis, one would expect to find its band towards the top of the gel. -FALSE Which of the following is NOT a typical cellular change that occurs during lung cancer? -elevated gas transport The probability of a couple having either a boy or a girl is ?.However, many families have more boys than girls and VICE VERSA. Why is the observed ratio of boys to girls in typical families different than the predicted ratio? Two of the answers are correct. There is a large random sampling error due to the small size of human families and the sex of each child is determined independently. What method must be performed to produce enough DNA for sequencing? -PCR Sister chromatids separate during -anaphase of meiosis II. The centromere -is not present on the chromosomes of the daughter cells until the S phase. While a prophage genome is integrated into the host cell chromosome, it is -latent, lysogenic, and temperate. Which of the following components of a virus is not encoded by its own DNA? lipid bilayer of viral envelope A plasmid vector and chromosomal DNA are treated separately with the same restriction enzyme.Which of the following might occur if the digested plasmid and chromosomal DNA were incubated together? -The two sticky ends of the plasmid could hybridize back together and recircularize as well as hybridize to both ends of a fragment of chromosomal DNA. In the Ames test, mutagenicity is normally tested on a strain of bacterium (Salmonella typhimurium) that cannot synthesize the amino acid histidine. Therefore, these bacteria require histidine in the growth plate to survive.A researcher performs the Ames test to evaluate the mutagenicity of a newly synthesized compound and notices that Salmonella typhimurium is living on a histidine-free growth plate. What can be assumed from these results? – The newly synthesized compound induces a mutation in the bacteria and the bacteria produce histidine. Which of the following statements is incorrect concerning sister chromatids? – All these statements concerning sister chromatids are correct. During HIV reproduction, spike glycoproteins – do not enter the cell with the virus. Transformation is the transfer of genes from dead bacteria to live bacteria. TRUE A species that has three sets of homologous chromosomes can have up to __different combinations of chromosomes in the gametes. -8 Consider an organism whose karyotype shows it to have a total of 60 chromosomes. How many chromosomes would be contained in the sperm of this organism? -30 Which of the following phrases INCORRECTLY finishes this statement? A genetic disease that causes death in infancy and has an autosomal recessive inheritance pattern can persist in a population because – if both parents are carriers, they have a 50% chance of having normal children.Place the following events of mitosis in the correct order. I. Sister chromatids align on the metaphase plate. II. The cleavage furrow forms. III. The nuclear membrane breaks up. IV. Sister chromatids condense. V. Sister chromatids separate. – IV, III, I, V, II Persons infected with HIV often die of opportunistic diseases because – HIV destroys T cells. Restriction enzymes bind to specific sequences of DNA to seal them together. -TRUE DNA methylation of a gene during spermatogenesis would result in – the inactivation of the paternal allele in the offspring. A small amount of DNA is collected from a crime scene.However, the amount of DNA collected is insufficient to perform the necessary experiments to link a suspect to the crime. What method could be utilized to increase the amount of DNA? – polymerase chain reaction (PCR) Polyploidy in plants – All of these statements are true regarding polyploidy in plants. The law of independent assortment states that the two alleles of the same gene will segregate from each other during gamete formation. -FALSE Only fathers can pass on pattern baldness to their sons. -FALSE Most oncogenes encode proteins that function in cell growth signaling pathways. TRUE During metaphase, – chromosomes are much shorter than they were in interphase. Bacteria contain plasmids because – they provide genes that allow the bacteria to grow and thrive in the presence of potential toxins. Maternal effect genes are inherited via the mitochondria. -FALSE Which of the following sequence pairs is a palindrome? – 5? -TCCGGA-3? ; 3? -AGGCCT-5? Which of the following base pairs would be targeted and repaired by a mismatch repair system? – A-G During prometaphase, the sister chromatids organize into a single row in the center of the cell. -FALSEPolydactylism is a dominant trait that results in extra fingers and toes in humans. A polydactyl man marries a woman with 10 fingers and toes. They have a child that has a normal number of digits. The phenotype of the man's father is unknown, but his mother has a normal phenotype. What are the genotypes of the married couple? -woman dd, man Dd Cells are normally limited to one DNA repair system that corrects DNA mistakes. -FALSE Which of the following INCORRECTLY states a principle of the chromosome theory of inheritance? -Gametes contain either a maternal or paternal set of chromosomes.

Monday, January 6, 2020

The Theories Of Piaget And Vygotsky - 2305 Words

Critically evaluate the theories of Piaget and Vygotsky in explaining children’s learning and development Learning and development is a major aspect of everyone and their day to day lives. Some people consider the term learning to have two definitions, these are informative learning which allows people to learn what fits their mental models and transformative learning which is the process of changing these mental models (Heorhiadi et al, 2014). There are two main theorists Jean Piaget and Lev Vygotsky, whose theories will be used to explain the way children learn and develop. Piaget (1954) proposed one of the most influential theories of cognitive development also known as a stage theory as it consists of a set of separate stages through which every child progresses during child hood and adolescence. His theory is regarded as universal, therefore the background and culture of the child is not taken into account. Piaget considered a child to be a ‘small scientist’ actively seeking and exploring the world around them, this way of thinking has contributed to our understanding of the world around us and how children think. Piaget also stated that the children must pass through each stage in order, even though some children may pass at a different rate than others. The main aspect of the theory centres on cognitive schemas which children develop. Schemas are cognitive structures which are used as a representation of the world around the child. The schemas will adjust and takeShow MoreRelatedThe Theories Of Piaget And Vygotsky933 Words   |  4 P agesContrast Using APA Style Jean Piaget and Lev Vygotsky are two renowned psychologists in the field of developmental psychology. The purpose of this paper is to summarize, to discuss the similarities, to discuss the differences, and to discuss what can be gained from a better understanding of the theories of Piaget and Vygotsky. A Brief Summary of the Theories of Piaget and Vygotsky The following sections explain the theories of Piaget and Vygotsky. Piaget’s Theory Piaget’s theory states that individualsRead MoreThe Theories Of Piaget And Vygotsky2389 Words   |  10 PagesIn this paper I will be comparing the theories of Jean Piaget and Lev Vygotsky, who were both very significant in the study of the cognitive development process of a child’s active construction of knowledge within an educational context. Piaget and Vygotsky were split by their differing styles of thinking as to how and why children learnt in different stages. Piaget was first to discover that children think in separate ways through the different periods of time in their childhood and he thoughtRead MorePiaget And Vygotsky s Theories Essay890 Words   |  4 Pagesdistinct yet, unique theories developed by Piaget and Vygotsky. These two theories are similar in various ways but also have unlike qualities, as well. Loudin (2012) suggests that even though Piaget and Vygotsky’s understanding and teaching of their theories are similar but stresses to point out that there is a distinct quality that one cannot see and wishes to share with readers. Other articles will discuss their level of understanding of either Piaget’s or Vygotsky’s theories. This paper examinesRead MoreThe Development Theories Of Piaget And Vygotsky941 Words   |  4 PagesMany psychological researchers such as Lourenco (2012) a rgue that the development theories of Piaget and Vygotsky are too fundamentally different to be amalgamated. Others, such as Bruner (1966) and Glassman (1994), support the similarities (Butterworth Harris, 2002), and state that together, they could give a more substantial understanding of development. This essay will focus on some of these similarities and differences. Consideration will be given to each of these approaches in regards toRead MorePiaget And Vygotsky s Theories1729 Words   |  7 Pagescentury, Jean Piaget and Lev Vygotsky dedicated their lives to the field of Developmental Psychology. They spent every possible day studying the wide span of physical, cognitive, social, and emotional growth and development over a human lifespan. Apart from many criticisms regarding their work, Piaget and Vygotsky’s enduring research is an important part in children s education around the world. In addition to spreading light on a child develops into an adolescent and adult. Piaget Jean Piaget’sRead MorePiaget And Vygotsky s Theories1008 Words   |  5 PagesComparing Piaget and Vygotsky Bruner (2015) discusses a time of great change in the world of psychology in Germany, America, and in Britain through contributions of several â€Å"new heroes [that] were much more holistic, much less reductionist†¦the worldwide major figures in the field of developmental psychology were now Lev Vygotsky and Jean Piaget†. Lourenà §o (2012) reiterated the importance of Piaget and Vygotsky as two influential developmental psychologists and added that â€Å"their contributions toRead MorePiaget And Vygotsky s Theory1400 Words   |  6 PagesPiaget and Vygotsky provide highly influential theories of learning which have enhanced the way children are taught in today’s schools (Pound, 2005, p.36). But despite the similarities, there were fundamental differences between their theories. In this assignment I will be comparing and contrasting their theories and relating this to my current personal experience of teaching and learning. Jean Piaget (1896-1980) developed a theory that the mind of a child evolves through a series of pre-determinedRead MoreA Comparative Analysis Of Theories Of Vygotsky And Piaget1446 Words   |  6 Pagescomparative analysis of the theories of Vygotsky and Piaget with emphasis on how the role of cultural context in child development is present in each of the theories. An in depth examination of each theory will be completed so as to give a clear understanding of the theories. The paper will also focus on the similarities and differences of the theories. Jean Piaget (1896 - 1980) was a developmental psychologist who introduced the theory of cognitive development in children. Piaget believed that childrenRead MorePiaget And Vygotsky And Theories Of Child Development2299 Words   |  10 Pagessubject of education and child development there are many different philosophers who each had their own theories, about the subject. This paper will focus on Piaget and Vygotsky and their theories of child development and how they are similar and/or different. It will also discuss how the role of cultural context in child development is presented in each of their theories of child development. Piaget believed that children are active in constructing their development and their understanding of environmentRead MorePiaget And Vygotsky Theory Of Cognitive Development Essay826 Words   |  4 Pages This essay seeks to identify and describe the concept of cognitive development and, highlight both Piaget and Vygotsky’s theory as it relates to cognitive development, and the significant differences between them. The term cognitive development refers to the process of growth and change in intellectual, mental abilities such as thinking, reasoning and understanding. It comprises of the acquisition and consolidation of knowledge. Infants draw on social-emotional, language, motor, and perceptual