Art Exhibit on Brown vs. Board of Education :: Art Race Segregation

Recreating the Elements Surrounding Brown vs. Board of Education Usually when I imagine an art exhibit I think of giant portraits of historic figures or arrangements of simple geometric shapes, and I am unable to comprehend how their worth exceeds the value of the materials put into them. These exhibits are usually organized to give an impression of the appropriate artist or time period, but the exhibit commemorating the Brown vs. Board of Education decision creates a model of the concepts and ideas surrounding its issues. The very first thing I noticed when visiting this exhibit was the wallpaper surrounding the entryway. This wallpaper consists of black and white portraits of people’s faces surrounded by and overlapped with bright neon stripes. These stripes are illuminated by black lights aimed from the ceilings and make it difficult to tell the race of the people featured. Although it accomplishes this goal quite well, at first glance I really only noticed how it detracts from the exhibit’s overall appearance. The exhibit and the area outside of it have a somewhat calm modern appearance with track lighting and wood floors so the neon wallpaper does not go well with its surroundings whatsoever which is something definitely not expected in an art museum. The main goal of the exhibit is to make race seem irrelevant and indistinguishable. The first example of this I noticed is obviously the wallpaper outside, which seems quite random and bizarre until the rest o f the exhibit is seen. Once inside the exhibit, I immediately figured out the wallpaper’s purpose as dealing with race issues just like the majority of the works in the exhibit. In the middle of the room, there is a large couch aimed towards a projection screen which shows two sets of home movies side by side of a white and black family. These movies feature scenarios such as birthdays, Christmas, and vacations and other scenarios that I could relate to, which are almost identical in each version. By showing the similarities in the private lives of white and black families, this part of the exhibit demonstrates that racial differences do not make people unlike one another.

Bio 201 Final Review

Which of the following is most likely to occur when a tumor-suppressor gene is mutated? – The tumor-suppressor gene and resulting protein may lose its function and ability to suppress cell proliferation. Mutations can produce a polypeptide with increased function. – TRUE ________can convert proto-oncogenes into oncogenes. – Nonsense mutations Most human embryos that are aneuploidy – are spontaneously aborted in the first trimester. Horses and donkeys are closely related species that can interbreed. However, the offspring produced are usually sterile and cannot reproduce. What term would best describe the offspring from this mating? alloploid Mitotic cell division is never used by organisms as a means of reproduction. – FALSE Which of the following accurately gives the distribution of phenotypes produced from a cross of purple dwarf pea plants that are heterozygous for flower color and plant height? – 63 purple dwarf; 28 purple tall; 27 white dwarf; 7 white tall A man with pattern baldness and a woman who has no baldness have a son who develops pattern baldness. Their son has a daughter who also develops pattern baldness. They determine that her expression of this trait is not a symptom of a medical condition.If her mother does not have pattern baldness, the daughter's genotype is ________ and her mother's genotype is _____________. – BB, Bb If a pink snapdragon is self-fertilized, the offspring are red, pink, or white. What type of inheritance pattern does flower color exhibit in this example? * incomplete dominance Which of the following organelle(s) has/have a genome separate from the genome in the cell nucleus? – mitochondria and chloroplast The inheritance pattern in which the mother provides gene products to the developing egg cells is called – maternal effects.If a testcross for two different traits produces more nonrecombinant than recombinant offspring, then the alleles for the two traits â €“ are on the same chromosome. An episome is – a plasmid that can integrate into the bacterial genome. Viral genomes must always be excised from the bacterial chromosome before viral components can be produced. – FALSE A bacterial cell must have ___________ in order to transfer portions of its chromosome to another cell. – an F factor What can be inferred from an organism that has undergone a gene knockout? – The GMO is a homozygote and the cloned gene carries a mutation.Which of the following is an example of a clone on the organism level? – identical twins Following treatment with restriction enzymes, what procedure would be used to isolate DNA fragments of different lengths? -gel electrophoresis At what phase of the cell cycle does p53 halt cell division if it senses DNA damage? – G1 Certain types of cancer are caused by viruses. – TRUE Consider a diploid species where n=5. If an individual of this species was found to have 11 chromosomes, it would be categorized as – both aneuploid and trisomic. At the end of meiosis I the cells are haploid and the homologous pairs are in separate cells. A chromosome with the centromere located two-thirds of the distance from its end could be classified as -either submetacentric or acrocentric. A woman comes to your genetic counseling center because she knows that Huntington disease occurs in members of her family. Her paternal grandfather was afflicted, but so far her father shows no symptoms. Her two great-great grandmothers on her father's side were healthy well into their 90s, and one of her great-great grandfathers died of unknown causes at 45.Testing for Huntington disease is extremely expensive, but she is concerned that she may fall victim to this disease and wants to plan her life accordingly. After examining her pedigree you advise her to – get tested because her father could be a carrier. What features of meiosis allow for independent assortment of chromosomes? – random alignment of homologous sister chromatids on the metaphase plate The genomes of mammalian mitochondria contain – All of the items listed are correct. In biparental inheritance, paternal and maternal gametes provide chloroplasts to the zygote. TRUE Paternal inheritance occurs in plants but not animals because animals do not have chloroplasts. – FALSE Horizontal gene transfer occurs when one species of bacteria takes up the DNA of another species that released the DNA when it died. – TRUE Which of the following does not contribute to the infectious ability of prions? – Prion proteins are deposited as aggregates. Baculovirus genomes are 133. 9 kb long and encode over 150 genes. This suggests that – their protein structures are very complex. Why is Taq polymerase required to perform a polymerase chain reaction (PCR)? Taq polymerase is heat stable and can therefore withstand the high temperature steps required of PCR that most other enzymes cannot tolerate. Why is the production of transgenic plants somewhat easier than the production of transgenic animals? – Plant cells are totipotent. Which of the following is an advantage of molecular pharming? – The yield of recombinant proteins in mammalian milk is quite large. Based on the gene and protein sequences that follow, what type of mutation-polypeptide effect has occurred? Normal gene: ATGGCCGGCCCGAAAGAGACC Mutated gene: ATGGCCGGCACCGAAAGAGACCNormal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp – base addition-missense The timing of a mutation during development has negligible effects on the severity of the genetic defect. – FALSE A gene created from the fusion of two gene fragments is considered a – chimeric gene. If a cell contains 20 units of DNA during G2, it will have 40 units of DNA in S. – FALSE In a tetraploid species, a euploid individual would have ___sets of chro mosomes. – 4 For any given species, cells in metaphase II of meiosis would contain 2? more genetic material than cells in metaphase of mitosis. FALSE Which of the following are incorrectly matched for a single-factor cross? – F2 generation / result of P cross A cross of a true-breeding smooth pod and yellow pod plants results in all smooth pod offspring.This indicates that – two of the answers are correct. Yellow and smooth are variants of the same gene, and smooth is the dominant trait. Pea plants cannot self-fertilize because one plant has either ovaries and stamens, but not both. – FALSE A trait that is expressed as a continuum rather than as a few discrete phenotypes is – codominant The genomes of mammalian mitochondria contain All of the items listed are correct. Epigenetic inheritance – can result in the expression of different alleles in different generations. A __________ bacterial cell is able to take up DNA from the environment. â €“ competent Baculovirus genomes are 133. 9 kb long and encode over 150 genes. This suggests that – their protein structures are very complex.Bacteria can exchange DNA between strains of the same species and between different species. – TRUE A researcher wants to clone a specific gene of interest. Why would he/she choose a viral vector for introducing the gene of interest into a host cell? A viral vector can infect living cells and take control of the host cell's metabolic machinery. Which of the following diseases affect DNA repair? – xeroderma pigmentosum Cancers originate from a single cell. – TRUE Consider a cell in which all of the homologous chromosomes experience nondisjunction during meiosis I. What would be the result of this event? – two polyploid gametes Which of the following is not a part of the mitotic spindle apparatus in plants? – centriole A nearsighted woman (Nn) with hazel eyes (Hh) marries a man with normal vision and hazel eyes (Hh). Their three children all have blue eyes and normal vision.What is the probability that their next child will have blue eyes and be nearsighted? – 3/8 How can you determine the genotype of a plant showing the dominant phenotype of red color? – Cross the red plant with a white plant to see if any white plants appear. When some recessive human diseases are present in the heterozygous state, incomplete dominance occurs. – TRUE In the sweet pea crossing experiment by Bateson and Punnet, the F2 generation had many more offspring with the phenotypes of purple flowers P, long pollen L and red flowers p, round pollen l than expected from independent assortment.This is because – All of the statements given are true. Quantitative traits – are correctly described by all of these statements. You breed a black, long-haired rabbit with a white, short-haired rabbit. All of the offspring have long, black hair. If the genes for hair color and lengt h are linked, what would be a possible ratio for the F2 population? | – 5 long-haired black, 4 short-haired white, 1 short-haired black, 2 long-haired white Bacteria can exchange DNA between strains of the same species and between different species. – TRUEA particle that consists of nucleic acids surrounded by protein and requires a host organism to replicate is – a prion It has been difficult to create an effective vaccine against HIV because reverse transcriptase cannot correct its errors. – TRUE Which of the following is a possible use for gene cloning? – All of the choices are correct. Which would be TRUE of comparing the DNA fingerprints from hair samples of identical twins? – Every band matches. What is required for a group of clones to be considered a contig? – The clones should have overlapping regions of DNA.A researcher determined that a strain of E. coli is producing a shortened version of a protein required for glucose met abolism. What type of mutation could be responsible for this shorter than normal protein? – nonsense mutation When cancer cells have the ability to migrate to other parts of the body, they are said to be – metastatic. The process by which haploid cells are produced from diploid cells is called – meiosis In a haploid dominant species – the multicellular organism is haploid and the zygote is diploid. DNA associates very tightly with nucleosomes because negative charges on DNA are attracted to positive charges of the histone proteins. The two-factor crosses performed by Mendel support the observation that – alleles for a given trait are distributed randomly among an individual's gametes independent of the alleles for other traits. A cross between two pea plants produces a population of 732 purple and 268 white plants.What is the genotype and phenotype of the parents that produced this population? – both parents heterozygous purple A couple has five sons. What is the probability that their next child will be a girl? 50% If the recombination frequency between gene A and B is 10 out of 100 offspring, gene A and C is 30 out of 100 offspring, and gene B and C is 40 out of 100 offspring, what is the location of these genes in relation to each other on a chromosome? – either CAB or BAC A modification of a gene or chromosome that occurs during gamete formation or early development which permanently alters the expression of that gene for the lifetime of the individual is called – epigenetic inheritance. A plant cell contains _____ genomes and an animal cell contains ______ genomes. – 3,2Drugs that are HIV protease inhibitors – prevent HIV protease from degrading host cell proteins. Transformation is the transfer of genes from dead bacteria to live bacteria. – TRUE Horizontal gene transfer occurs when one species of bacteria takes up the DNA of another species that released the DNA when it died. à ¢â‚¬â€œ TRUE The entire collection of a species' proteins is known as its – proteome Which of the following pollutants could be reduced with the use of bioremediation? – All of the choices are correct The main goal of polymerase chain reaction (PCR) is to generate many copies of DNA. – TRUEWhat would result from a single nucleotide deletion (point mutation) within the coding sequence of a structural gene? – a frameshift mutation, producing a different amino acid sequence altogether Somatic cell mutations are heritable. – FALSE MAPK and MEK are intracellular signaling proteins that mediate cell division induced by growth factors. When mutations in the normal MAPK and MEK genes result in an abnormally high level of MAPK and MEK activity and increases in the rate of cell division, then the mutated gene is called a(n) – oncogene The formation of the bivalent during meiosis – contributes to the genetic diversity of a species.A male is hete rozygous for the trait that produces freckles on the skin, and he has freckles. If he marries a woman who is also heterozygous for freckles, ______ percent of their children will be freckled and __________ percent of their children will be heterozygous. – 75% freckled, 50% heterozygous A person with blood type O can donate blood to people of any blood type. – TRUE Epistatic gene interactions do not follow Mendel's laws of inheritance. – FALSE Which of the following statements correctly describes a quantitative trait? – People who are homozygous for the group of genes associated with skin igment have either lighter or darker skin than those who are heterozygous for those genes. The donor cell makes ___________ whose function is to bring F- cells close enough to transfer a ___________ to the recipient. – a sex pilus, single strand of DNA Integrase – cuts the viral genome and is required for both prophage and provirus formation.Which of the fol lowing is an advantage of cDNA libraries? – cDNA lacks introns and therefore reflects all the genes expressed by a particular tissue or organism. What is it called when a cloned gene recombines with the normal gene on a chromosome to create a genetically modified organism (GMO)? gene replacement p53 is a tumor suppressor gene that acts as a sensor of DNA damage – TRUE The movement of DNA polymerase continues unimpeded if a thymine dimer is present in the DNA double helix. – FALSE In mammals, males are ________ and females are ____________. – hemizygous, homozygous An organism that is heterozygous for two traits can produce a maximum of _______ different gametes for these traits. – 4 In plants, most chloroplasts are inherited from the maternal plant because maternal gametes contribute the most __________ to the zygote. – cytoplasm Place the following events of bacterial transformation in order from first to last. – DNA replication b â €“ an enzyme joins F factor DNA ends c – sex pilus shortens d – DNA transfer e – an enzyme cuts F factor DNA -c, e, d, b, a Which of the following acts as a carrier of foreign DNA and is needed to clone a gene? – plasmid and viral vectorWhich of the following statements is TRUE of restriction enzymes? – They protect bacterial cells from invasion by foreign DNA. Which of the following types of physical mutagens produces thymine dimer mutations? -ultraviolet light Which of the following would occur from a mutation in the gene's promoter region? -The rate of transcription may increase or decrease.Which of the following is an overgrowth of cells that serves no useful purpose? – tumor The karyotype of a normal human male would show a total of 23 pairs of homologous chromosomes. -FALSE Meiosis I produces __________, and meiosis II produces _________ cells. – two haploid, 4 haploid Which of the following mutations will not alter the amou nt of genetic material on the chromosomes? -inversion You discover a new sunflower that has blue flowers instead of yellow. When you cross this blue variety with a common yellow variety you get blue and yellow speckled flowers. What type of inheritance pattern does this gene exhibit? codominance A person with blood type O can donate blood to people of any blood type. – TRUE The sex of all animals is determined by chromosomes. – FALSE Albinism in most animals is an epistatic trait characterized by a lack of melanin pigment in the eyes, skin, and hair. If the allele for albinism is a, the allele for brown coat color is B, and the allele for red coat color is b, which of the following genotypes would result in an albino cow? -aaBB and aabb Bacterial cells only contain one copy of its circular chromosome. -FALSE When a virus has a broad host range, -it can infect many cell types or species.A researcher wants to introduce the human gene encoding tissue plasminogen activator (used to dissolve blood clots) into a mammal so that the protein will be secreted into the milk of the mammary gland. What is required for the researcher's success? -The gene should be placed next to the promoter of a gene that is expressed in mammary cells. The main goal of polymerase chain reaction (PCR) is to generate many copies of DNA. -TRUE Sickle-cell anemia is a human disease that occurs as a result of what type of mutation in the ? -globin gene? – missense Which of the following statements about cancer is FALSE? Most cancers involve genetic changes that are passed from parent to offspring. G banding can be used to detect genetic mutations. -TRUE Two babies are mixed up in the hospital nursery. The blood types of Couple 1 are A and O and the blood types of Couple 2 are AB and B. Baby Joe has blood type O and Baby Jane has blood type A. Who are the parents of Baby Joe and Baby Jane? – Couple 1, Baby Joe or Baby Jane; Couple 2, Baby Jane The single-factor crosse s performed by Mendel support the observation that – the two alleles for a given gene are distributed randomly among an individual's gametes.Genomic imprinting can result in offspring with identical genotypes that have different phenotypes. -TRUE In biparental inheritance, paternal and maternal gametes provide chloroplasts to the zygote. -TRUE The two daughter cells that are formed as a result of binary fission – All of these statements are correct. The chromosome must be ___________ in order to fit into the bacterial cell. – supercoiled by topisomerases Which of the following statements about genomic libraries and cDNA libraries is TRUE? – A cDNA library is derived from mRNA and is made using reverse transcriptase.Bioremediation utilizes newly developed synthetic chemicals to decrease pollution in the environment. -FALSE What type of gene mutation occurred to produce the following protein sequence? Normal: JAYBIRDCATPAW Mutated: JAYBIRDCATPAW -nonsense S hould a genetic abnormality arise, ________ prevent a cell from progressing uncontrollably through the cell cycle. – checkpoint proteins In mitosis, the main difference between plant and animal cells is that – plants produce a cell plate to segregate the daughter nuclei, while animals form a cleavage furrow. Color blindness is a recessive X-linked trait.A normal couple has a color-blind child. Who else in this family is probably color blind? – the child's maternal grandfather The DNA methylation state of a zygote will be maintained throughout the life of the organism and then passed on unchanged to its offspring. -FALSE The bacterial genetic material is -localized to a nucleoid region. Which of the following is true concerning a somatic cell mutation? – Only a small group of cells within the organism is affected by the mutation. A repair enzyme recognizes an incorrect structure in the DNA and directly converts it back to a correct structure.Which of the f ollowing DNA repair systems is responsible for the correction? – direct repair During crossing over in meiosis, an incomplete exchange of genetic material occurs. This would most likely produce – a deficiency in one homologue and a duplication in the other homologue. Height (tallness) in humans is a polygenic trait. Assume the following: There are 4 genes that determine height (Aa, Bb, Cc, Dd). Each dominant allele adds 2 inches of height to an individual. The height of the recessive individual (aa, bb, cc, dd) is 5 feet. What is the height of a person with the genotype (AA, Bb, cc, DD)? – 5? 10?A mutation in the gene encoding the enzyme that cuts F factor DNA during conjugation would result in – an inability to separate the recipient DNA from the donor DNA. A pro- strain of bacteria, which has not been in contact with any other strains, develops the ability to produce the amino acid proline. This mutant â€Å"rescue† could have been caused by â₠¬â€œ addition of the pro+ gene via transduction. Which of the following is true regarding transformed cells that are plated on growth media containing ampicillin? – Each colony began with one antibiotic resistant cell and all cells in the colony are resistant to the antibiotic ampicillin.Which of the following proteins is responsible for advancing a cell through the four phases of the cell cycle? – cyclins If the copy number of a proto-oncogene is increased by gene duplication then the proto-oncogene has undergone – gene amplification. All of the following are chemical mutations EXCEPT – X-rays. Why must the life cycle of sexually reproducing species alternate between haploid and diploid stages? – Meiosis must occur at some point in the life cycle to prevent a doubling of chromosomes in each generation. Which of the following inheritance patterns is matched with an inaccurate molecular basis? Simple Mendelian inheritance; The protein produced by a single allele cannot produce the dominant phenotype. A cell undergoing meiosis that contains sister chromatids may be either haploid or diploid. -TRUE When a single-gene mutation can have phenotypic effects at multiple stages of development, it is – pleiotropic. The karyotype of a young patient shows two Barr bodies per cell. What condition might this child have? – Triple X syndrome Prokaryotes – include bacteria and archea Viroids have a genome but do not translate any of it to protein -TRUEBacterial infections have become much more of a threat to human health due to – All of the events given have increased the threat of bacterial infections. Chromosomes are replicated during the ______ phase. – S Sexual life cycles include both haploid and diploid stages. – TRUE Which of these is NOT a reason that Mendel used pea plants as a model to study inheritance? -They cannot self-fertilize. What is the difference between the blood types, A, B, and O ? -A and B individuals have different modifications made to their carbohydrate tree. O individuals have no modifications made to their carbohydrate tree.If a male cat with orange fur produces female offspring with calico fur, what color was the mother cat? -black or calico Which of the following is not an emerging virus? -Epstein Barr Plasmids can help bacteria grow faster. -TRUE What type of science is a researcher performing if she were conducting experiments to try and map the location of a gene on a particular chromosome? -structural genomics The main goal of polymerase chain reaction (PCR) is to generate many copies of DNA. -TRUE The major way that meiosis II differs from mitosis is that -in meiosis II, the cells are haploid.A person who inherits an extra X chromosome will have -Down syndrome. In humans, having dimples in the cheeks is a dominant trait. If a child has dimples but only one of her parents does, what are the genotypes of her parents? -one parent must be dd, the ot her parent could be either Dd or DD Mating a purebred Labrador retriever to a purebred poodle to produce â€Å"Labradoodles† is an example of -hybridization Barr bodies will -be formed in both males and females, depending on the number of X chromosomes possessed by an individual. Mendel's laws do not adequately explain all the patterns of inheritance. TRUE Viral release from a eukaryotic cell -requires the production of lysozyme encoded by the viral genome and kills the infected cell.Which of the following is NOT added to each of the 4 assay tubes when performing the dideoxy method for DNA sequencing? -DNA polymerase Which of the following is TRUE of short tandem repeat sequences (STRs)? -Their length is variable among different individuals and they can be used for DNA fingerprinting. Under what circumstances would a molecular geneticist need to use a bacterial artificial chromosome (BAC)? when cloning large, eukaryotic genomes One major difference between metaphase I and met aphase II is the presence or absence of bivalents. -TRUE If you were to examine a typical population at a single locus, you would find more copies of the wild-type allele than any other allele. -TRUE In Thomas Hunt Morgan's experiments, the ratio of red-eyed flies to white-eyed flies appeared to follow a simple Mendelian pattern of inheritance.What observation(s) did he make that led to his conclusion that the white-eyed trait was actually not a simple Mendelian trait? He was able to correlate the expression of white eyes to the inheritance of an X chromosome because only F2 males had white eyes and the trait is recessive. After a fragment of DNA containing the gene of interest has been inserted into a vector, how are the gaps between the two pieces of DNA sealed together? -DNA ligase catalyzes the formation of covalent bonds in the DNA backbone. Ionizing radiation can produce which of the following? -free radicals Which protein directs apoptosis? -caspase A horticulturist is breedi ng a new variety of houseplant in which two genes control leaf color.G (allele for green) is dominant to g (yellow) and B (second allele for green) is dominant to b (yellow). The recessive homozygous condition of either gene will mask a dominant allele. What color is a plant with the genotype GgAa? -GREEN You are breeding different varieties of roses in your garden. When you cross a true-breeding yellow â€Å"Texas Beauty† rose with a true-breeding â€Å"Ruby† red rose, you get all red roses. But when you cross a â€Å"Texas Beauty† yellow with the yellow variety â€Å"Jealousy,† you get a 9:7 ratio of red to yellow flowers! What can you conclude from these results? There are epistatic interactions between at least two genes for rose pigment. How does the reproduction of HIV and lambda phage differ? -HIV contains reverse transcriptase enzyme, while lambda phage does not. Offspring receive both the alleles for a given trait from one parent. -FALSEA scienti st has been growing a bacteria strain for some time in culture media containing very few nutrients. The cells are growing slowly, so she enriches the media with amino acids and carbohydrates. To her dismay, instead of growing faster and to higher densities, the bacteria begin to die. What has caused this strange result? The bacteria is infected with a temperate phage, and has switched from the lysogenic cycle to the lytic cycle. If a large protein is run on a gel slab and subjected to electrophoresis, one would expect to find its band towards the top of the gel. -FALSE Which of the following is NOT a typical cellular change that occurs during lung cancer? -elevated gas transport The probability of a couple having either a boy or a girl is ?.However, many families have more boys than girls and VICE VERSA. Why is the observed ratio of boys to girls in typical families different than the predicted ratio? Two of the answers are correct. There is a large random sampling error due to the small size of human families and the sex of each child is determined independently. What method must be performed to produce enough DNA for sequencing? -PCR Sister chromatids separate during -anaphase of meiosis II. The centromere -is not present on the chromosomes of the daughter cells until the S phase. While a prophage genome is integrated into the host cell chromosome, it is -latent, lysogenic, and temperate. Which of the following components of a virus is not encoded by its own DNA? lipid bilayer of viral envelope A plasmid vector and chromosomal DNA are treated separately with the same restriction enzyme.Which of the following might occur if the digested plasmid and chromosomal DNA were incubated together? -The two sticky ends of the plasmid could hybridize back together and recircularize as well as hybridize to both ends of a fragment of chromosomal DNA. In the Ames test, mutagenicity is normally tested on a strain of bacterium (Salmonella typhimurium) that cannot synthesize the amino acid histidine. Therefore, these bacteria require histidine in the growth plate to survive.A researcher performs the Ames test to evaluate the mutagenicity of a newly synthesized compound and notices that Salmonella typhimurium is living on a histidine-free growth plate. What can be assumed from these results? – The newly synthesized compound induces a mutation in the bacteria and the bacteria produce histidine. Which of the following statements is incorrect concerning sister chromatids? – All these statements concerning sister chromatids are correct. During HIV reproduction, spike glycoproteins – do not enter the cell with the virus. Transformation is the transfer of genes from dead bacteria to live bacteria. TRUE A species that has three sets of homologous chromosomes can have up to __different combinations of chromosomes in the gametes. -8 Consider an organism whose karyotype shows it to have a total of 60 chromosomes. How many chromosomes would be contained in the sperm of this organism? -30 Which of the following phrases INCORRECTLY finishes this statement? A genetic disease that causes death in infancy and has an autosomal recessive inheritance pattern can persist in a population because – if both parents are carriers, they have a 50% chance of having normal children.Place the following events of mitosis in the correct order. I. Sister chromatids align on the metaphase plate. II. The cleavage furrow forms. III. The nuclear membrane breaks up. IV. Sister chromatids condense. V. Sister chromatids separate. – IV, III, I, V, II Persons infected with HIV often die of opportunistic diseases because – HIV destroys T cells. Restriction enzymes bind to specific sequences of DNA to seal them together. -TRUE DNA methylation of a gene during spermatogenesis would result in – the inactivation of the paternal allele in the offspring. A small amount of DNA is collected from a crime scene.However, the amount of DNA collected is insufficient to perform the necessary experiments to link a suspect to the crime. What method could be utilized to increase the amount of DNA? – polymerase chain reaction (PCR) Polyploidy in plants – All of these statements are true regarding polyploidy in plants. The law of independent assortment states that the two alleles of the same gene will segregate from each other during gamete formation. -FALSE Only fathers can pass on pattern baldness to their sons. -FALSE Most oncogenes encode proteins that function in cell growth signaling pathways. TRUE During metaphase, – chromosomes are much shorter than they were in interphase. Bacteria contain plasmids because – they provide genes that allow the bacteria to grow and thrive in the presence of potential toxins. Maternal effect genes are inherited via the mitochondria. -FALSE Which of the following sequence pairs is a palindrome? – 5? -TCCGGA-3? ; 3? -AGGCCT-5? Which of the following base pairs would be targeted and repaired by a mismatch repair system? – A-G During prometaphase, the sister chromatids organize into a single row in the center of the cell. -FALSEPolydactylism is a dominant trait that results in extra fingers and toes in humans. A polydactyl man marries a woman with 10 fingers and toes. They have a child that has a normal number of digits. The phenotype of the man's father is unknown, but his mother has a normal phenotype. What are the genotypes of the married couple? -woman dd, man Dd Cells are normally limited to one DNA repair system that corrects DNA mistakes. -FALSE Which of the following INCORRECTLY states a principle of the chromosome theory of inheritance? -Gametes contain either a maternal or paternal set of chromosomes.

The Theories Of Piaget And Vygotsky - 2305 Words

Critically evaluate the theories of Piaget and Vygotsky in explaining children’s learning and development Learning and development is a major aspect of everyone and their day to day lives. Some people consider the term learning to have two definitions, these are informative learning which allows people to learn what fits their mental models and transformative learning which is the process of changing these mental models (Heorhiadi et al, 2014). There are two main theorists Jean Piaget and Lev Vygotsky, whose theories will be used to explain the way children learn and develop. Piaget (1954) proposed one of the most influential theories of cognitive development also known as a stage theory as it consists of a set of separate stages through which every child progresses during child hood and adolescence. His theory is regarded as universal, therefore the background and culture of the child is not taken into account. Piaget considered a child to be a ‘small scientist’ actively seeking and exploring the world around them, this way of thinking has contributed to our understanding of the world around us and how children think. Piaget also stated that the children must pass through each stage in order, even though some children may pass at a different rate than others. The main aspect of the theory centres on cognitive schemas which children develop. Schemas are cognitive structures which are used as a representation of the world around the child. The schemas will adjust and takeShow MoreRelatedThe Theories Of Piaget And Vygotsky933 Words   |  4 P agesContrast Using APA Style Jean Piaget and Lev Vygotsky are two renowned psychologists in the field of developmental psychology. The purpose of this paper is to summarize, to discuss the similarities, to discuss the differences, and to discuss what can be gained from a better understanding of the theories of Piaget and Vygotsky. A Brief Summary of the Theories of Piaget and Vygotsky The following sections explain the theories of Piaget and Vygotsky. Piaget’s Theory Piaget’s theory states that individualsRead MoreThe Theories Of Piaget And Vygotsky2389 Words   |  10 PagesIn this paper I will be comparing the theories of Jean Piaget and Lev Vygotsky, who were both very significant in the study of the cognitive development process of a child’s active construction of knowledge within an educational context. Piaget and Vygotsky were split by their differing styles of thinking as to how and why children learnt in different stages. Piaget was first to discover that children think in separate ways through the different periods of time in their childhood and he thoughtRead MorePiaget And Vygotsky s Theories Essay890 Words   |  4 Pagesdistinct yet, unique theories developed by Piaget and Vygotsky. These two theories are similar in various ways but also have unlike qualities, as well. Loudin (2012) suggests that even though Piaget and Vygotsky’s understanding and teaching of their theories are similar but stresses to point out that there is a distinct quality that one cannot see and wishes to share with readers. Other articles will discuss their level of understanding of either Piaget’s or Vygotsky’s theories. This paper examinesRead MoreThe Development Theories Of Piaget And Vygotsky941 Words   |  4 PagesMany psychological researchers such as Lourenco (2012) a rgue that the development theories of Piaget and Vygotsky are too fundamentally different to be amalgamated. Others, such as Bruner (1966) and Glassman (1994), support the similarities (Butterworth Harris, 2002), and state that together, they could give a more substantial understanding of development. This essay will focus on some of these similarities and differences. Consideration will be given to each of these approaches in regards toRead MorePiaget And Vygotsky s Theories1729 Words   |  7 Pagescentury, Jean Piaget and Lev Vygotsky dedicated their lives to the field of Developmental Psychology. They spent every possible day studying the wide span of physical, cognitive, social, and emotional growth and development over a human lifespan. Apart from many criticisms regarding their work, Piaget and Vygotsky’s enduring research is an important part in children s education around the world. In addition to spreading light on a child develops into an adolescent and adult. Piaget Jean Piaget’sRead MorePiaget And Vygotsky s Theories1008 Words   |  5 PagesComparing Piaget and Vygotsky Bruner (2015) discusses a time of great change in the world of psychology in Germany, America, and in Britain through contributions of several â€Å"new heroes [that] were much more holistic, much less reductionist†¦the worldwide major figures in the field of developmental psychology were now Lev Vygotsky and Jean Piaget†. Lourenà §o (2012) reiterated the importance of Piaget and Vygotsky as two influential developmental psychologists and added that â€Å"their contributions toRead MorePiaget And Vygotsky s Theory1400 Words   |  6 PagesPiaget and Vygotsky provide highly influential theories of learning which have enhanced the way children are taught in today’s schools (Pound, 2005, p.36). But despite the similarities, there were fundamental differences between their theories. In this assignment I will be comparing and contrasting their theories and relating this to my current personal experience of teaching and learning. Jean Piaget (1896-1980) developed a theory that the mind of a child evolves through a series of pre-determinedRead MoreA Comparative Analysis Of Theories Of Vygotsky And Piaget1446 Words   |  6 Pagescomparative analysis of the theories of Vygotsky and Piaget with emphasis on how the role of cultural context in child development is present in each of the theories. An in depth examination of each theory will be completed so as to give a clear understanding of the theories. The paper will also focus on the similarities and differences of the theories. Jean Piaget (1896 - 1980) was a developmental psychologist who introduced the theory of cognitive development in children. Piaget believed that childrenRead MorePiaget And Vygotsky And Theories Of Child Development2299 Words   |  10 Pagessubject of education and child development there are many different philosophers who each had their own theories, about the subject. This paper will focus on Piaget and Vygotsky and their theories of child development and how they are similar and/or different. It will also discuss how the role of cultural context in child development is presented in each of their theories of child development. Piaget believed that children are active in constructing their development and their understanding of environmentRead MorePiaget And Vygotsky Theory Of Cognitive Development Essay826 Words   |  4 Pages This essay seeks to identify and describe the concept of cognitive development and, highlight both Piaget and Vygotsky’s theory as it relates to cognitive development, and the significant differences between them. The term cognitive development refers to the process of growth and change in intellectual, mental abilities such as thinking, reasoning and understanding. It comprises of the acquisition and consolidation of knowledge. Infants draw on social-emotional, language, motor, and perceptual

Small Business vs Big Business - Free Essay Example

Sample details Pages: 7 Words: 1988 Downloads: 1 Date added: 2017/09/21 Category Advertising Essay Type Compare and contrast essay Tags: Information Essay Did you like this example? Big Business Starts as Small Business Software to support a growing enterprise There are two certainties in life – death and taxes. While both are unavoidable, at least the taxes issue can be managed. But managing taxes, and business finances in general, takes detailed information. Considering how most small businesses get their start in accounting for their business operations, it is not surprising that information gathering becomes one of the most time -consuming and frustrating tasks around tax time. Fixing the problem from the beginning and keeping a system with the detailed data you need on an ongoing basis is the key to avoiding the rush and to building a business information framework that spans the life of the business entity. In order to understand how to solve the problem, it is important to understand the evolution of business accounting. Not how the concepts or practices have evolved, but how technology has (or has not) been applied to certain problems, and where the gaps are. Just starting out – the business in infancy The first things a new business owner generally does is get a business license, get a computer, and run down to the discount store to buy a copy of QuickBooks or maybe Microsoft Excel. Now, this business owner isn’t necessarily prepared to properly handle the accounting for the business, but he understands that he has to do something. Keeping a check register, at the minimum, lets him know how much money is in the bank. And that’s what it’s all about for the small business person – cash flow and cash availability. But the focus on the checkbook frequently causes the business to postpone implementing deeper, more beneficial processes. With a focus on the checkbook, the business manages cash by counting payments out and receipts in. But the nature of the payment or the receipt is the true question that must be answered and accounted for. It is surprising how many businesses sti ll keep ledger cards – those manual 35’s in a box where customer and vendor information is kept. It is a simple method, and provides the business a way to keep individual account records. But the fact that this detail information is not part of an integrated system creates a greater potential for lost or inaccurate data. Further, the greater the volume the more difficult and error-prone managing the information becomes.  © InsynQ, Inc. 2005 Page 1 of 5 Appgen Business Software It is at this point that the business seeks to find a more comprehensive means to manage the additional business data. This is another buying decision the business owner must m ake, introducing a new system which can handle the additional activities around accounts receivable, accounts payable, inventory and sales orders, etc. The business was already keeping track of products or services, customers and vendors. But here we are at a step where new systems and processes must be introduced . A belated effort, this after-the-fact implementation of customer, vendor and item tracking, establishes the means to manage more business activities as part of an integrated system. The difficulty comes in loading the historic information and learning new systems . Depending on volume, the quality of the manually-kept data, etc. , it may be determined that historic transaction details are not to be entered. So, the business moves forward with a better system for managing business activities and data, but loses the value of the early transaction detail. The next steps – handling volume and growth The business has implemented an accounting system which helps to keep track of customers, vendors, items, and cash. More detailed processes are introduced as the business requirement grows – offering perhaps more specific information on costs of certain products, or summaries of customer purchases or item sales activity. This data provides a much mo re informed basis for b usiness decision- making, but also impacts the systems as the volume of data to be managed grows. Growth may present itself in many ways – growth in the number of products or services offered, growth in the number of transactions processed regularly, growth in the dollar value of transactions, or growth in the number of employees who need access to the system. All of these areas impact the ability of the system to continue to support the business requirements. Quite frequently, a certain â€Å"density of data† is reached and the current system is not able to efficiently manipulate and manage the volume. Here again is another buying decision. Can the existing system be expanded to handle the additional volume? Or must a new system yet again be introduced? The business process requirements may not have changed, but the earlier choice of systems may cause a forced change simply due to business volume or number of users. The frustrations of changing business systems are compounded the further into the business lifecycle the change comes. Much of the historic intelligence of the business is derived from the earlier days of the business; data which reflects the stages and activities of the business over time. When a business reaches a point where data volumes force a systems change, a worst-case scenario occurs: The volume of historic data is too great for the current system, and loading it into a new system  © InsynQ, Inc. 2005 Page 2 of 5 Appgen Business Software takes a huge amount of time and effort. Unfortunately, this task often proves too daunting for the company, so again valuable historic detail information is lost and summary information is loaded into the new system. Operationally Specific Systems As the business matures – and in order for the business to mature in a healthy manner – specific and detailed information must be captured and analyzed. Systems which take a broad view of the business, offering only gene ral information and process support, frequently do not supply the business with the levels of intelligence truly required. For example, a manufacturing business needs to fully understand and manage the manufacturing processes and materials supply to ensure profitability and consistent product quality. A retailer needs to know which products sell in which markets in order to ensure product stock and availability to key ustomers. And all of this information is time-critical if the business is to make necessary adjustments in time to benefit from them. This level of detail can only come from a system which incorporates a certain specific orientation towards the operational processes of the business. The fact of selling a product to a customer is an activity which gets recorded, but the additional details of the customer location, pricing levels, purchasing levels, salesman, inventory item, and warehouse location tell the rest of the story. Over time, the business owner can then bett er understand customer purchasing habits, inventory item turnover, supplier dependencies a wealth of business intelligence. This data is then used to assist the business owner or management in determining the specific activities or actions necessary to keep the business moving forward and improving performance. In the end, it is the demonstration of well-defined processes, deep insight into the business operational metrics and financial performance, and the ability to effectively and accurately report on this information that creates a basis for proveable business value. There is One When looking at the business accounting and finance systems available in the market – particularly considering those which have earned a level of market share – there are visible gaps – big ones. This is clearly reflected in the numbers, where Intuit QuickBooks leads in the small business market, but has no reciprocal in the midrange or enterprise markets. QuickBooks fits into t hat early space, where the business is just starting out and, maybe, extending into keeping more detailed customer, vendor and item information. MS Excel is also a winner for very small and new businesses, as the spreadsheet is a simple and easy solution to creating an electronic check register. But there comes a point where a business has  © InsynQ, Inc. 2005 Page 3 of 5 Appgen Business Software requirements that extend beyond the ability of the small business software. Sometimes, the mere thought of change is so abhorrent (usually based on a bad initial implementation experience) that the business attempts to use the software far beyond what it was built to handle. Other application makers offer systems that have a number of small business features, but that also offer more in-depth or complex capabilities to handle the growing business. These systems, too (such as Peachtree, MAS2000, etc. ) have a great potential to be outgrown, and can be costly implementations which han dle only a portion of the business lifecycle. Larger, module-based systems (such as Great Plains, Oracle, etc. ) offer a broad range of functionality, integration, and data management capability. They typically address more – and more detailed business processes, and can scale to very large sizes. But the cost and complexity of these systems is often the barrier, and given that there is no clear seed product (small business version of the big business software), the upgrade path is unclear and problematic. Microsoft is seeking to impact this area, preparing to offer a small business accounting system which would in concept seed to the much larger Microsoft Business Solutions applications. Given the huge gap between the â€Å"typical† small business system and the upper-levels in the MBS catalogue – the transition from very small to very large is not likely to be made in the single step Microsoft may envision. Each stage of business requirement typically d rives to a buying decision. This buying decision is met with anxst, as considerations include not only cost, but data conversion vs re-loading, new process or system design and setup, user training, proofing the system (running parallel? ) and a host of other issues, not the least of which is the business benefit to be derived. All the anxst, the frustrations, and the repeated buying decisions can be avoided. There is a system which scales – from the very small business to the very large business – and that has been proven in high availability, high performance, large volume systems for over 25 years. And this system offers flexibility – ease of use for the new or small business user, a broad range of feature-rich and functionally powerful business and finance applications, and a comprehensive development tool to allow even the most complex business requirement be crafted as part of the system. And the best feature is the database – which grows with th e business throughout the business lifecycle. Information is power, and this system provides you with the ability to capture all your valuable business information from the inception of the business through growth and on to maturity.  © InsynQ, Inc. 2005 Page 4 of 5 Appgen Business Software The system is from Appgen. For the small business, it’s the MyBooks Professional system, offering a broad range of functionality within an easy-to-understand interface. Simple flowcharts help describe the accounting process, and assist new and novice users with effectively managing business activities within the system. As the business requirements increase, the MyBooks Pro suite of applications may be customized, or may be replaced with the full-featured modules from the Appgen Custom Suite of applications. The database is the same, however, so there is no loss of any level of data or detail. As the business needs more specific functionality to support its processes, the Appgen 4G L development system is used to make modifications to standard applications, or to create completely new customized applications, designed and suited for the unique and particular requirements of the business. Again, the database is the same, but may be extended to capture any number of additional data elements desired. Appgen offers the business a single buying decision: a single database; a clear application migration path; and a way to taylor the system to meet specific business needs. And for the cost, there is no comparable alternative. Visit www. Appgen. com and discover the only accounting system your business will ever need. Appgen Business Software Always-On Technologies, powered by InsynQ www. Appgen. com 866-206-1781  © InsynQ, Inc. 2005 Page 5 of 5 Appgen Business Software Don’t waste time! Our writers will create an original "Small Business vs Big Business" essay for you Create order

Essay about Idiot Nation - 886 Words

In â€Å"Idiot Nation,† Michael Moore discourses on the collapse of American education system and the three main reasons behind it: politicians’ ignorance, shortage of teachers, and the rise of Corporate America. Moore first points out how ignorant the President and politicians are by stating that the President cannot simply identify whether Africa is a nation or a continent. Next, Moore attributes the lack of funding in education to the fact that politicians prefer to build bomber than to improve our education system; this leads to shortage of resources, overpopulated classrooms, and decrease of books available for students. He then notes that the low salaries of teachers, which are caused by the insufficient funding of education, result in†¦show more content†¦Eisenhower’s nominee as ambassador to Ceylon,† being â€Å"unable to identify either the country’s prime minister or its capital during his Senate confirmation hearing† (130). Moore’s use of examples here not only helps elucidate his point, but also clearly supports his claim that American officials are ignorant. Thus, Moore’s strategy of using exemplification is successful both in clarifying his argument and convincing readers of his position. Throughout his excerpt, Moore also uses surprising statistics as an argumentative strategy to efficaciously deliver his message to readers and stimulate us to reflect on the point he brings out. For example, he uses some astonishing statistics to show us how people are wasting their time doing trivial things instead of learning and reading. He states that â€Å"[t]here are forty-four million Americans who cannot read and write above a fourth-grade level,† but in the meantime, a considerable number of people know sports and â€Å"can answer all thirty obscure trivia questions in less than 120 seconds† (129). Reading these surprising statistics can stimulate readers’ reactions and arouse them; readers will be surprised to find out that they are wasting so much time doing useless things and be impressed by the astounding result that they may reflect on how they use their time. As a result, Moore’s use of surprising statistics can effectively convey his messag e and stimulate readers to reflect on his point. A third strategy that Moore uses isShow MoreRelatedIdiot Nation Essay995 Words   |  4 Pagesurged to go on to college. This leads many people to believe that it will help our country reach the goal of becoming a smarter nation. However, in his essay Idiot Nation, Michael Moore argues that the exact opposite is occuring. We are becoming a nation full of idiots. Sadly, Michael Moore is correct. The majority of the people in this country are, indeed, idiots. This is due to the nation’s poor educational system and the people’s lack of gratitude and motivation. First of all, America’sRead MoreIdiot Nation : Draft 1 Essay1325 Words   |  6 PagesAndrew Romero Prof. Cathy Arellano ENGWR 300 Purple 28 September 2016 Idiot Nation: Draft 1 Across America, you d be hard pressed to find a person that doesnt agree that everyone should receive a free education. Because of this, most everyone goes to high school, or at the very least receives an equivalent education. However, after this free education is done, many high school graduates are pushed to continue their studies in colleges and universities. And while these facilities are believed toRead More`` Idiot Nation `` By Michael Moore1591 Words   |  7 Pagesthere could be a spokesperson for criticizing American politicians, the educational system, globalization, large corporations, the war in Iraq, and many other debatable issues, American author of â€Å"Idiot Nation†, Michael Moore would be the ideal candidate. In this piece, Moore argues that America is a nation built upon a clueless, illiterate society of people, a sub-par educational system, and manipulative corporations. All which are governed by brainless politicians. Moore effectively creates his argum entRead MoreThe, Idiot Nation, By Michael Moore1421 Words   |  6 Pagespublications who spread the idiocy of these politicians, and influences the American people to buy into their idiocy and elect and re-elect more idiots into power, keeping the American people ignorant and stupid. In Michael Moore’s article, â€Å"Idiot Nation,† he presents us with several high-ranking officials, throughout America’s history, who represented us as a nation despite an acute lack of knowledge for the positions there were to hold: Maxwell Gluck, ambassador to Ceylon in 1956, William Clark, deputyRead MoreIdiot Nation By John Taylor Gatto1537 Words   |  7 Pagesas technology and health care or education, but compared with other develop nations, the united states education system is still behind many country including United Kingdom, Japan, China. America’s standards of education are far lower than several other countries, because the American public education systems is less effective, students are lack of motivation to learn. According to Michael Moore, in the book Idiot Nation, and John Taylor Gatto in Against School, they argue that the education systemRead MoreSummary Of Michael Moores Idiot Nation978 Words   |  4 Pagesin his popular essay, â€Å"Idiot Nation† that comes from the book Stupid White Men and other Sorry Excuses for the State of the Nation, discourses on how our political system, lifestyles, and technology are the reason for our countrys becoming so idiotic. Nevertheless, he believes that the educational system is suffering the most. Moore accentuates how ignorant the President and politicians are by stating that the President cannot simply identify whether Africa is a nation or a continent. Moore seesRead MoreIdiot Nation, Michael Moore, Critical Essay Critique1280 Words   |  6 PagesCritical Essay In Rereading America an excerpt by Michael Moore entitled â€Å"Idiot Nation† focuses on the collapsing educational system in the United States of America. Moore brings to light his view on the failures of the educational system and the lack of financing that has been caused from the top of the food chain. Politicians as well as American corporations contribute to the decline in education according to Moore. He attempts to give the reader a clear picture of where America places theRead MoreExamination of the Education System in Idiot Nation, by Michael Moore 1351 Words   |  5 PagesIn his essay, â€Å"Idiot Nation,† Michael Moore directly conveys the horrid truth behind American education when he utters the sheer words, â€Å"the knowledge (students) acquire in school is not going to serve them throughout their lifetimes. Many of them will have four to five careers in a lifetime. It will be their ability to navigate information that will matter† (Moore 141 ). According to Moore, American education today is by no means preparing students for the real world of work. In fact, he infers thatRead MoreAnalysis Of Green Day By George W. Bush1922 Words   |  8 Pagesone of the most controversial presidents in history and prompted some of the loudest outcries from the public. The music world became very involved in this particular fight, many artists from multiple generations and genres protested Bush. American Idiot by Green Day is one of the best examples and the most well-known protest of Bush and his administration. However, despite its popularity and acclaim it did receive a lot of criticism. Going against such a powerful and influential person in societyRead MoreProblems and Aspirations of Youth as Highlighted in the Novels of Chetan Bhagat5079 Words   |  21 Pagesadapted into a movie called ‘3 Idiots’, though Bhagat has stated that he was not involved in the scriptwriting in anyway, and was involved in a controversy with the director and the producer of the movie over crediting his contribution to the script. Directed by Raj Kumar Hirani, and starring Aamir Khan, R. Madhvan, Sharman Joshi, Kareena Kapoor, and Boman Irani in pivotal roles, it was released on 25 December, 2009. About a week after the release of the movie, ‘3 Idiots’, Chetan Bhagat claimed for

Ventria Bioscience free essay sample

Bioscience and the Controversy over Plant-Made Medicines In this paper I am writing on the Ventria Bioscience and the Controversy over Plant-Made Medicines Case. Ventria Bioscience is a company that is trying to commercialize pharmaceuticals made from genetically modified plants. While Ventria is gaining opposition from regulators, activist, and environmentalist; they could succeed if they use their relevant stakeholders and specific strategies, information, financial incentive, constituency building, to influence regulators. There are many groups that have a stake in Ventria’s action. There are some stakeholders that hold a lower salience such as, the environmentalist, consumer advocates, and food-safety activist. Which are, Friends of the Earth, and Environmental of California. As far as market stakeholders involved with Ventria, you have the rice industry, including rice farmers and producers. These groups are apart of the market in which Ventria wants to enter into. Rice farmers can be a family owned business, whereas, rice mills tend to be owned by larger organizations such as: Agribusiness giants, ADM, Far West Rice, Pacific International, and Sun West. The public is a market because they are going to be customers for Ventria’s product. However, there are most prominent stakeholders that each have a specific interest and source of power. Beginning with non-market, Ventria has a lot of regulations to abide by; for example, the FDA, EPA, and USDA regulation. Ventria needs all three of these regulatory approvals if they even want their business to evolve. The FDA is responsible for the safety and effectiveness of food and medicines. The EPA is responsible for the environmental safety of food crops that are genetically engineered. As for the USDA, they have oversight of genetically modified crops that are being tested in fields. Given that Ventria wants to grow their crops in California, they have to be aware of the CRC, California Rice Commission. The CRC is appointed under the Rice Certification Act to review any varieties of rice, to ensure the production and milling of rice is done with a public interest. These stakeholders are standing in the way of Ventria’s attempt to solve malnutrition. For the market stakeholders it begins with Scott Deeter, president and CEO of Ventria Bioscience, he built the company, analyzing proteins and coming up with ideas. Then you have Dr. Raymond Rodriguez, he is a molecular biologist that founded Ventria Bioscience. He approached Dr. William Rutter, founder and chairmen of the biotechnology firm Chiron, to become an investor in the company. As the company progressed, Dr. Rodriguez built a board of directors of biotech leaders and seasoned entrepreneurs. This included Dr. William Rutter and Dr. Pablo Venezuela. William H. Rutter, an attorney and venture capitalist. Ron Vogal, and bio-entrepreneur Dr. Robert Crea. Later recruited to the board were Thomas N. Urban, Melvin Booth, and David Dwayer. Together these board members and their organizations provide 85 percent of financing for the company. If these relevant stakeholders were to have a dialogue, many opinions on how to reestablish the company’s protocol would be said. Specifically, strategies how to get pass the regulation issues and gain the approval of different advocates. They will need to figure out a way to address their potential risk. Environmental and consumer groups feel as though Ventria will contaminate other rice crops. If GM crops were to contaminate other crops, California will be at risk of losing Japanese exports. They would have to talk to their research and development team to deal with the risk, and where money should be spent in doing so. The board of directors may come up with the option of growing the crop in another country opposed to California. This would be a good way to ensure non-contamination, and eliminate the risk of â€Å"super weeds† being produced in California. It will also eliminate the regulation from the CRC. This could gain activist and environmentalist approval, since those were their main arguments. Another opinion may come up to write an appeal to congress. Explaining to them how they can reduce harm in countries, from the benefits of their pharmaceutical. This would put pressure on congress or even regulators to change their mind. Like the Tobacco case, regulators intervened to help the citizens. Regulators are doing this to Ventria to protect citizens from possible health issues and the environment from harm. If Ventria wants to influence relevant regulators they can go about it in three different ways. However, I feel two of the three strategies will benefit the company most. They can do an information strategy. Ventria can provide the government and policy makers with information to influence their actions. They could hire a lobbyist that would be aware of the regulations and developments that may affect the company. This representative would communicate and persuade an organizations support as they consider a particular regulation. For example, Ventria could explain their case to the CRC. They would provide information explaining their objective and express the benefits that can come from their product. If the CRC is aware that this medicine can help with malnutrition, dehydration, and diarrhea they would understand the benefits. These factors could help a lot of countries that suffer from hunger. Ventria can also have some of their CEO’s give a testimony to regulators and organizations. Given that all of them have been involved with biotechnology to some degree, they will be able to provide a great amount of facts. They can provide data to educate and influence regulators to better understand their objective. Ventria can also promote a Constituency-Building strategy. They will seek support from organizations or people who are also affected by the public policy. Reading the Coca-Cola case, citizens of India felt as though Coke had money so they could do what they want. Coca-Cola became aware that they needed to create sustainable communities or consumers wont use their product. Ventria needs to enhance groups to meet their objectives. They need to reach out to them and clarify the safety of their project and the benefits from it. This will gain their support, thus allowing Ventria to have a greater influence on regulators once they see the approval of many groups.

How are women represented in The Winters Tale Essay Example For Students

How are women represented in The Winters Tale Essay The Winters Tale is a sixteenth-century comedy of William Shakespeares containing many possibilities of a tragedy occurring throughout the play, such as when Hermione dies and Perdita is left in an unpopulated area. The various female characters representations are significant for the plot. More importantly, with the exception of Paulina, they are portrayed as being passive, obedient characters who are inferior to their male counterparts. A modern-day audience would perhaps disagree with the oppression of women evident within this play, but in the cultural context of Shakespeares society, women were inferior to men and subsequently expected to obey them without question. The character of Paulina, however, is welcomed by the modern audience as being a more modern character who defends the rights of women, for example Hermione and the abandoning of Perdita. At the time Shakespeare wrote the play, women, more specifically Mary and Elizabeth I, had held the position of monarch in England and it is possible to suggest Paulina is the personification of a new contemporary idea of a female. Paulina, is portrayed as being very strong emotionally, as she is willing to stand up to Leontes and make him see his own faults, but she could also be considered extremely cruel for the emotional punishment and torture she inflicts on Leontes during the sixteen years that he is without Hermione. Paulina also manages to convince the male characters that Hermione is innocent, indicating a reasonable degree of power. Leontes insults anybody who agrees with Paulina or, more importantly, anybody who disagrees with him, for example, Antigonus, who is Paulinas husband. Shakespeares portrayal of Leontes, who has a low opinion of the women in the play, reflects predominant contemporary male attitudes. His statement to Antigonus regarding Paulina shows that he expects the man to be dominant, What? Canst not rule her? Hermione is the opposite of Paulina as she appears to be very weak, always forgiving Leontes, but she is perhaps stronger than Paulina as she is willing to accept her oppression and remain dignified throughout. Upon being accused of adultery with Polixenes by Leontes, Hermione is given the simple reply, No, by my life, Privy to none of this. This is a highly ironic statement. Leontes has condemned Hermione to death and Hermione is swearing on her life that she is innocent. The effect of this irony is a reinforcement of Hermiones innocence, showing Leontes to be an unreasonable, jealous tyrant. This technique employed by Shakespeare is illustrating a clear division between which of the characters upon stage we are to support in the court case. It is certainly possible that Shakespeare based the character of Hermione on the medieval idea of female Patience. Female Patience is a concept that women will allow themselves to suffer in order to please their husbands. For example, patient Griselda from the Clerks Tale by Geoffrey Chaucer shows this virtue. Hermione is portrayed as being a forgiving, obedient lady who will forever remain loyal to Leontes, similarly to Griselda. Another response of Hermiones while she is on trial is: The emperor of Russia was my father. This ironic statement would likely cause a contemporary Shakespearean audience, or a modern audience to feel more sympathy for Hermione, as her calmness and unexpected argument with her husband convince us that she has done no wrong. Although her father is powerful, she is weak and defenseless, creating a form of irony. Also, Shakespeare is showing that Hermione hails from an honourable family. However, although it is admirable that Hermione manages to remain calm even during this traumatic time, with the way Leontes has been treating her there is a feeling amongst a modern audience that Hermione should not be so calm and should perhaps let Leontes know exactly what she thinks of him and his actions, as women would be more likely to do during recent times. However, her silence would have been considered virtuous by a contemporary audience, creating a high level of respect between the character and its audience. The audience is led to believe that, although Hermione has won the case with the Oracle, Leontes has won the battle when Hermione faints, apparently to die. This is perhaps Shakespeares most literal display of Hermiones character as although she appears strong and dignified on the outside, on the inside she is weak, which is shown by Hermione fainting to her apparent death. The death of Hermiones son, Mamillius, is also a large factor in Hermiones death. Hermione was very protective of Mamillius; feeling that Leontess allegations against her would have a detrimental effect on his reputation. Using your analysis of Shakespeare's text, suggest ways in which act 3 scene 5 of Romeo and Juliet could be performed EssayTime as a healer is a main theme of the play. Shakespeares effect of the sixteen-year gap on stage emphasises the fantastical nature of the play. Despite the obvious potential for a tragedy within this play, the supernatural re-birth of Hermione by the end is likely Shakespeares distinction between comedy and tragedy. I also disagree that the final scene balances this fact as although they are reunited, gain Perdita as a daughter and Florizel as a son-in-law, they will never be able to replace their son and heir to the throne, Mamillius, as he is and will always be dead. No matter how much Leontes repents for his sins, Mamillius cannot be brought back. Leontes matching of Paulina and Camillo might also seem joyful in theory, but these two are not in love and matching them up is simply a demonstration of Leontes power returning to him. In fairness to Leontes, he may not intentionally be controlling Paulina and may have paired Paulina off with Camillo to give her a good, worthy husband. The union of Paulina and Camillo could also be a sign of nature taking its course, as marriage is viewed as a natural union. The reconciliation of Hermione and Leontes could also be deemed as natural. However, this first criticism is definitely accurate in that the last scene cannot possibly excuse Leontes previous actions towards Hermione. Hermione is always willing to take back Leontes no matter what sins he has committed, but Leontes is not willing to forgive Hermione for sins that she is not even guilty of. Hermione is the stronger character of the two as a result of this. It is possible that Shakespeare has intended to portray the females as emotionally-stronger characters as a way of ridiculing the male attitude towards females during this time. However, Queen Elizabeth I was recognised as a dominant and powerful ruler, which Queen Hermione was not. Queen Elizabeth was never married and subsequently not the subject of any oppression, but Hermione was oppressed by her husband. This could be a suggestion by Shakespeare that if men had listened to women more and treated them as equals, perhaps Leontes would not have enraged himself to such a degree over Hermione and Polixenes friendship. Hermione does exactly what is asked of her by Leontes and is accused of adultery for it. Women were vastly underappreciated by men back in the 16th century and The Winters Tale illustrates this perfectly. One critic has suggested that, The action of the play is to repair the damage caused by Leontes jealousy, however, Camillo flees, Hermione endures, and Paulina, though she criticizes the king, will eventually restore his wife to him. However, Leontes areas of power are shared between the various female characters within the play and this gives the impression that Leontes has lost control and makes the audience feel that the women are in power rather than Leontes. As soon as Leontes loses Hermione and Mamillius he becomes vulnerable and Hermione and Paulina capitalise on this more than anyone. However, Leontes does have the final say as, although Paulina would like for Leontes to wait for her permission before marrying again, he is under no real obligation to do so and can just as easily refuse as accept her proposal. His intense vulnerability is what causes him to give in to Paulina. In conclusion, it could be argued that women are presented as being worthy of more power than they actually possess. In the cases of Paulina and Hermione, the two characters are extremely sensible and know how their roles are limited by the laws of Sicilia. Shakespeare asks the contemporary audience to respect these women and support them over jealous tyrants such as Leontes. I believe that Shakespeares addition of these characters shows that he believes that despite being expected to be the calm, calculating characters, men can often get out of control and this is ironic as it is not expected of them but it can often happen anyway. The undervaluing of women could be a mistake as they, like Paulina and Hermione, have plenty of intelligence to offer.